Description :
From Genome Similarity Track
Location :
Scaffold_290:34063- 35146
Sequence
1083 bases(100 bases per row)
TTGTACTGTGGTCTTTCCATTATCGGCTCTCATCATAGTCAGCCAGGTCTACATGTTGGTCAACTTGATCAGCGGCGGCTTCATATGCCAGATTTATCGA
CTCAGCATACCTTCGAGAGACCACCAAGACAAATCCTTGTTCTTTTGGTACTTGTTCCTTCTTTAACCACCTAACTACCTTGATTCTTCGTGCGATATTG
AGGTACCGAGGCTAACGTTGACTAACTTCAGAATTTGTCGACGTCACACCTCTTAGATCATTGTTGTGATCCATCTTTTCCCTCTCGTGAACCACATTTT
CAACTGTTCCGAGGTCGTCATTTTGTAGAGATATTTCTATATACCCTCCAACATGTATCTGCGCATACTGAACCAACGTCTGACCCTCGGGTTTCATAAA
TTGACATCGGCCGCATAATTGCACTCGAAGTTTATCACCGAGACAGATTGTTCCGTTCGCCAGGTCTAACCGAATAACGGCTGCGACCATTAACTCATTG
CCCAAGATGACGTCTTGGCTCCCATAGCGGCCACCTACACATTAAAATTTACACCCTGTTTCTATTTTGAGTGATCTTGATGCGAGTGTGGCCTTCCATA
GTATAGATGGATTCCCCAACGCCAATACACTCTTGTCGTATTTACTTTCGTCGAATTGTCAGCCTACCCTACGAGCATAAGCGGCAGCTAGGATTGAAAT
TTCGGCTCCAGTATTAAACAACAAGTTTGCGCGATTATTTTTGACTTTTGCAGAGGCTTTATCTTGCCTAAATCACTTCGTAGAAGTATGGTATTACCAG
GAGCCCCTGGATTCGCCCGGCAATAATTCTAACCGCATCACTGATTTTCTCGAGCAAAGCCATTACGATCATCAAGGGAAGCGACATGGACCATAGGATA
GTTTACCATCTTCGATATATTTTCAATCGTCGTAGCTGGTGTATCCATCTCATCCTTTGGCTGCCTTTGCACATTCGTGAAGACACAAAAATTAGAACGC
TCGGCTATTACCAAAGGAAAACCTGGTGAGCGTTCTAATTTATCAACTTCTTAGTCTCCTCCAGCAACATTCAGGTGTGCATG