Description :
From Genome Similarity Track
Location :
Scaffold_546:3406- 5091
Transcript NameFunction/comments
Phyke_g10179hypothetical protein

Sequence
1685 bases(100 bases per row)
ACGGCGTGGCAAACGCCGACGTTGATATCCCCAAGCGCTTGTCGTTTGTAAGTGCCGGATCACAGTCCAAGGACGTCGAAGGTGGTTATGCCGGCGTCAA
GACCCCCGGGGCCGAAATCGAAGGAGGGGCCCTGCGCGAAGGAGGCATGCCCGTGCTGACAAGTAGGGAAAATCTCGGTCTACTCTTCCAATACTCAACT
GTCGGCCTCGTGTACGGGCTGCTTCCCGAGACTATCTACCCGTTTCTGCAGAAGTACCTCAACTGTTCCGGTTCCCAAGTCACAGCGGCAGCTCAACTTG
TGGTTCTCCCGTGGAGTTTCAAGGTCTTCTATGGCATCCTGTCCGATTGTCGACCCATTTTCGGTTATCGCCGTCGGCCGTACATGCTCATTGGTTGGGG
GATCTGCTTCATTATGCTAATTATCATGGCCATCATACCTGCCGGTAAACCTTACTTCATCGTCGCATCAGACCGCGACATCGACATAGGCGATTACACA
CCGGAGATCAAGGCTCGCATTAACTACGACGCATCCGATGAAGGTGCCAAATACGTTATCATCATGTTCTTTGCGGCCGTCGGCTACGTGCTTTCAGACG
TGTGTGCTGACAGCATCACACTTGAACTCGCTCAGCGTGAGCCGTTGGACAAGCGTGGCAAGACTCAGTCGATGATCTACACGGTTCGAACGGCCATGGT
GATCTTCGGTGAGATCCTTGTGGGCTTTTTCTTTAATGGCGAAGACTACGGTGGCGACTTTGACTTTTCACTTAGCTTCCCGCAATTGATGATCATCGTG
GCTGTACTCACAACCCCTGTATTCCCTGTGACGTGGTTTTTTATcaaagaggagaaggctgaagctgccaattTCCGTGAGTATATCAGCAACTTCTGGG
ACTTGCTGTGCTCTCGAGCCATGTACCAAGTCATAGCGTATCTCTTTTTCGCCGGCATCTTCGCTAACATCACTTACACCGGTAGTTCCCCCGTTGCCTC
GTACTTAGTTAAGGTCACTCCGATCAACAGCACGATCAGCAGTATCCTCGGTAACCTGCTGTTTGCAGCTGGAATCATGATCACGTCTAAGTGGGGGCTT
CACTGGaactggcgctggatgatTGTATTCActggtgctgtggtgatTATCGTCGACTGCACGGTATCACTTCTTGTGATTTGGGATGTTTTTCGAAATC
AGTGGTTCTGGCTTGGTCCTCCTATCGCTGTGCAGCTTCCGTACGGCGTCGGATGGATAATCTCGACATTTTGCGTGGTAGAGCTCGCACAGATTGGCAA
CGAGGCTGCCGTCTACGGCCTCATCACAACTGTAACCAACGTGGCACAGCCATTTGCTACGTCGTTGACACTTGCAATCGATGGTCATTTTAATGTTACC
AACGAACGTGTGCAGGAGGACGACCACTCGATTCGAGCTGACATCACCTATACGATCGCCATCATGTATGCGATGACCATTTTCTCATGGGTATTCCTGT
TCCTGCTACCGCCACAGAAGGCAGAAACACAGGCACTTGTTCGCAAGGGTGGACACAGCAAGCTCCTGGGAGGTGTGACGACGTTTTACCTGATCTTTGC
CATTATCTGGTCCATCATGACCAACATCATGGCCATGTTCGACAGCACATCGTGTTTGATCATTGCTGGAGGCAGGGGTTGCTAG