Description :
From Genome Similarity Track
Location :
contig_6:340597- 341958
Transcript NameFunction/comments
g2123.t1OQS05022.1 Major Facilitator Superfamily (MFS) [Thraustotheca clavata

Sequence
1361 bases(100 bases per row)
TTTCTACAGCATGCCGTGTTAGAGGAATGAGCATGGTCTCGAGGGCGAGACCGCACGTATACACCAGCGCTGCCGCCACGAAGCACAGTCGGTATCCGTA
AGCCTCCACGATCATTCCACCGAGTACGGCGCTACCTGCCCAAGAGGCAACAGTCAGTCCCTCCAGCGAATTCCAACGCGCACGATGCGTCTTGGGCACG
AAATCCATGAGAAGTGATCGCCGGAGTGGTTCCGTGCACTGCATCAACGCTCCGTGCGCTAGGAACAGCACACTCTGGTCGGTCACGTCGTGCGAGACTG
CCATCAGCAGCAAACTGATGGTGCCAAGTGCACGCGTGGCCACGACCATGGCATTCGCCCAGTAGCGCTCGACACCATTTGCGCTAGGAGCGACAGCAGT
GCAATCACCAGTGGCTGCAGTGCGAAGAGGGTCTGCACTCGAACCGGAGACAGCGCGTACTCGTTGAGAAAGAAGAGCGGGAAGAACGCCGTGACAAGTC
CGGTGCCGTTGCTCACAAGGAAGTCCGACACAAACAGCAGGTACGGGACGTGCGCAGTGTCGAGCATCCCGCAACACGCCATGACGGGGCGTACCGGGAC
ATCCTCGCCATCGTCACTCCGCACTGGAGCAGCCAAGTAGTAGCCGCTGGTTACTGAAGGAACCCTTGAAGACCGGAGAAGTTGAGAGAACTCGCTTGTC
GAGGGCATGTGCACACGAGAAAAGCTCCCTCCTCGTTCGGAGGCGGAGCTTTCTCTCTCGCTGTACTCGGATGTGAAGTTGCGCTCGATGGAGCTCAGCT
CGCGCTCGATAGCGAACACGTACTGCCGGTTCTCAAATGCTAGGTCGTCGTTGAACTGAAACAGCACGACCATGGACACTGCCGCGATGAACGCTCCGAA
AAGCAGAACGGGTCGCAGTGCTGCAAGCGTCCACGCATCACCGTGCTTCCATAGCAACAGCATCGCACTCAAAGGCCCGAGCACAAGCGCGACGTTGCGC
ATGACGTACTTCAGCGTGAACGGCGCTGATCTTTGCCCTACCGGCACCGAGTCAGCGAACAGAGCCTCCATGGCCGAGCTCTGGAAGGCAGTGAAGGCCC
CCCATAGTCCGAAAGCCACGTAAATGAGGACCATGTCGCCTAACTCGAAAGCCAACGCTGTCAGCACCGAAGCCACGACGCCGAGAACGCCTGAAAGCGC
GAGGATCCGGTCTCGACGTGTACTGTCCGCTGCATAACCAGCTGGGAATGCGCACAGTAGCTGGGCTAGACCCTGAATGCCCTTGACGAAGCCCACAGGG
ACGTTGGAAGCCGTCAACACGTACACGTAGCCCGATAGCACCTGCTGCGAAATAATACTAC