Description :
From Genome Similarity Track
Location :
contig_6:340569- 341930
Transcript NameFunction/comments
g2276.t1XP_002904418.1 Major Facilitator Superfamily (MFS) [Phytophthora infestans T30-4

Sequence
1361 bases(100 bases per row)
TTTCTACAGCATGCCGTGTTAGAGGAATGAGCATGGTCTCGAGGGCGAGACCGCACGTATACACCAGCGCTGCCGCCACGAAGCACAGTCGGTATCCGTA
AGCCTCCACGATCATTCCACCGAGTACGGCGCTACCTGCCCAAGAGGCAACAGTCAGTCCCTCCAGCGAGTTCCAACGCGCACGATGCGTCTTGGGCACG
AAATCCATGAGAAGTGATCGCCGGAGTGGTTCCGTGCACTGCATCAACGCTCCGTGCGCTAGGAACAGCACACTCTGGTCGGTCACGTCGTGCGAGACTG
CCATCAGCAGCAAACTGATGGTGCCAAGTGCACGCGTGGCCACGACCATGGCATTCGCCCAGTAGCGCTCGACACCATTTGCGCTAGGAGCGACAGCAGT
GCAATCACCAGTGGCTGCAGTGCGAAGAGGGTCTGCACTCGAACCGGAGACAGCGCGTACTCGTTGAGAAAGAAGAGCGGGAAGAACGCCGTGACAAGTC
CGGTGCCGTTGCTCACAAGGAAGTCCGACACAAACAGCAGGTACGGGACGTGCGCAGTGTCGAGCATCCCGCAACACGCCATGACGGGGCGTACCGGGAC
ATCCTCGCCATCGTCACTCCGCACTGGAGCAGCCAAGTAGTAGCCGCTGGTTACTGAAGGAACCCTTGAAGACCGGAGAAGTTGAGAGAACTCGCTTGTC
GAGGGCATGTGCACACGAGAAAAGCTCCCTCCTCGTTCGGAGGCGGAGCTTTCTCTCTCGCTGTACTCGGATGTGAAGTTGCGCTCGATGGAGCTCAGCT
CGCGCTCGATAGCGAACACGTACTGCCGGTTCTCAAATGCTAGGTCGTCGTTGAACTGAAACAGCACGACCATGGACACTGCCGCGATGAACGCTCCGAA
AAGCAGAACGGGTCGCAGTGCTGCAAGCGTCCACGCATCACCGTGCTTCCATAGCAACAGCATCGCACTCAAAGGCCCGAGCACAAGCGCGACGTTGCGC
ATGACGTACTTCAGCGTGAACGGCGCTGATCTTTGCCCTACCGGCACCGAGTCAGCGAACAGAGCCTCCATGGCCGAGCTCTGGAAGGCAGCGAAGGCCC
CCCATAGTCCGAAAGCCACGTAAATGAGGACCATGTCGCCTAACTCGAAAGCCAACGCTGTCAGCACCGAAGCCACGACGCCGAGAACGCCTGAAAGCGC
GAGGATCCGGTCTCGACGTGTACTGTCCGCTGCATAACCAGCAGGGAATGCGCACAGTAGCTGGGCTAGACCCTGAATGCCCTTGACGAAGCCCACAGGG
ACGTTGGAAGCCGTCAACACGTACACGTAGCCCGATAGCACCTGCTGCGAAATAATACTAC