Description :
From Genome Similarity Track
Location :
Scaffold_124:34044- 39082
Transcript NameFunction/comments
Hyaar_Emoy2810358predicted protein

Sequence
5038 bases(100 bases per row)
AATATTCGAGGTTATGCGCATAGAATCTGTAAATTCTAGGCTAGGAAGGTCTCCAAAGAAGTGTTTTTAAAGAGTGAGTTTATTACCAACATTATCTGTC
ATACCAACCACCACCCTGATTTCCGCAGCTGCTCCTCGCTCCTGCGCGATGGTAGTACGAGATGTGCTCACCATCCGCCTCGTCTGTCACCTGCAGCACA
CCACAATATACAAAATGAAAACCAATCCTGGACAACGGCATTTTCTTGATGGCTTGGGACCTGGCGGTTTTTAAGCCAGTAAAACACCGTTTTCCAACAC
TCCTCCCCAGGGATCACGCCTTTTCAAGTCCAACGAGAGTACGTAAAGCTTGTAGTCGAGGCGCTGGGAGTGGCTTAATTAGTATGTCAGCCAGCATGTC
GTCCGTAAACACGTAGGTCGGTTTAATCGTGCCTTTCTTCTAGTAATCACTAATAAAATTGAGACGAACGTCCACACGTTTTGCCTGGCTTGAGCTTGCT
TCATTTTCAACTCGTTTGATAGCAGCTTGGTTATCCATTTTCATGACCATGGGAATCGCAACCTGAAATCCAATTTCTCCCGCCAACTCCTTTAAACCGA
GAAGCTCTTTGGCGCCAATGGACGCCGCAACATATTCAGATTCAGCAGTCGACAACGCCACTGCCGTTTGCTTCTTGCAATGCCATCCGACGATCATTCC
ATTTATCCGGACAATTTCACCACTAATGGACTTTCGGTCTCGCTTATCTCCAGCAAAATCAGCATCAGTGAAACACTCGATGCGTAGGGGCAAATTTGGT
CCACCGTCGCAATTCATAGATAATTTGAGATCAGCACTTCCAGCCAAGTAGCGCACAATACGTTTCGCCAACTTGTAATCTCCTATAGTTGGTGCGTGCG
CACGCCGGGAAGCATGGTGGACATCAAATGAATGTCTGGTCTCGTGCAGCGAGCAATCCAAACCAAACTTTCGAGCAGCGACTGAAATGTCTTGATGGTT
GGTGTTCAGGTGTACCAGGACCATTTGCTGGCAGTAGCGACCCTCCTCCAGATTGATCGCCATCCAAAAAGTCTCCTCCCATGGGAGCTCTGACTGATTT
CGCTTTATCGAGCCCATGCTTGGACAGAAATTCAAGGATAGTCGATTCTTGATCAATCTTGTAACCAGAATTCGAATCGTAGTGGACTCGCATGCCAAGA
AACTTCTCAGCAAGTCCAAGGTTCTTCAGCTCAAGGCATGTCATCTGCGAAAAGAAATCATCAACACGCTGGCCACTGGTCCCGGTCACCAAGAGATCAT
CCACGTATGTGCCAACAAGGATAGTGCCGTCCGAATCGGACTTAAAATACAAACAAGTGCCCGTAATGCATTGCACATATCCAATGTTCGTCAGTGTTGC
ATGAAGGAGCTGGTGCCACAGTCTCCCAGCCTGCTTCAATCCATAAAGGCTCCGTTCCAAGCAAAGAGAAGATCTTTGGGGCTATTCACATCATATTGGA
GAGCTGCTTCAACGTAAAAACCATTCCTTCAGGAATACGAAGATAAATATCAATTTCATCTTTTTTAGCAGCTCGCACATAAGTACTTGGCACGTCGAAA
TGCTTCGCTGGTGTACGCCAAATCCATGCAATAGCCTATATAGCCTTGGCACTTGTCATGTCCAACTGCGGCAAAATTCAGCAGAAAATTCACGCCGAGT
ACATGTTCATTGCCACATGCAACAAGTCTAGCTTTGTAACGTTCAATTCCTCCGTCACTTGTGCGCTTTTTCTTGTCTATCCACTTAGTGTGCAAACGTT
GCACACCAGGTTCGGATTTGACCACTCTCCACGTGTAATTTGCACGCAACGATGTAAGCTCTTCACGATTGGCGCGCTCCCACAATATTTTGTCGGGACT
GCGCATCGCCTCGCGATAATTCTTCAGGTTGGGCAGATGCGCAAAACCTGCGAGACAGCAGCAACGACTGCATTCACCACATCACCAGATGCTGGCGAAG
GGTCCATTTGAACGGCAGTTGTGACTGCATTTACAAGTTCATGCGATGGCTTCAAAACACTTGAGATATACATCTCTGCCTCTAGTTTCCGCAACGACTT
TTTTGTGGTACGCTGAGACCGTCGTAGCTCATGTTCAATCGGTTTAGTACGCTTTTCAGCCGTACTCCCCTCAGCTGGGCCTTCCAGCCGTCCAGTAGGA
TTCATTACAGTCACTTGACAACCAGCACTAGCGAACTGATCGTGGCGCGTGCGCGCTAGGTCTTCGAATTCAGTCTCGGCCTCCTTTTGCAAGACCTCCT
CCAATTGTTTATTGTCCTCGTCAGTGAGAGTCTTGACTTGACGGACGTGCCGTGTAGTGATGACAGAGCGATCACGTGAAATGTAAACGCGAAAACCTTT
CGTTTCATCGCTCTTTCCAAAAACAACTCCAACCTTGGAGCGCTGCTTCAATGAATCCTTTTCGGGATCACGGTACACCTCACACTGAGACTCAAAAGCG
ATAATATCCACCAGATTCGGGGATTTTCCCGTCAACATCTTGACGGGAGACGCCCTCTCAGGGTTTGAACGGGTTGGCATTCTATTAAGCACGTACGCCG
CATATTCGGCTGCATCACTCCAAAAAGAAAGTGGTAAATCGCACGAAAATATCATACATCGAACCATATTCATAATCGTCCGGTGCATGCGCTCCGCCTT
GCCATTTCCCGCCTGGTTTCCAGCCTCCGTTATTTGCCTTGCAACTCCAGATTCACGACGTAACAAATCAACATTCTTGTATTCTCCGCCACCATCTGTA
CGGAGCACATCCACACGGCAATCGTAACGTTTCTCAAAATAGACTAAAAATTGCTCAATTTTTTTGCAGCTTGGTCCTTGGTTTTAGAGAGAAGTACTCG
ACTATAATCGGTCTTATGATCAACAAAATTGACCAGATACCTGTTGCCTCTGCGATCGCGCGGTGTAATTGGACCCTTGAGGTCGCTGCAGATCACTGAA
CCAACGCGATCCGTCGGAGCACCCGTACTGGTGTCCTTTGTTGGCTGAGCGGCCCGTGTCTGCTTTCCTTATGCACAGATTGAACAATGCATTCCTTCAT
TATCCGTCAACTTAATCCCAGAGCTTGGAGTACGCGCGAGACGTTTAATCGTGTCAAGATTTAGATGACCAAAACGCNNNNNNNNNNATACAAAATGAAA
ACCAATCCTGGACAACGGCATTTTCTTGATGGCTTGGGACCTGGCGGTTTTTAAGCCAGTAAAACACCGTTTTCCAACAAAGGTGTGCTACTACCTTGTC
AAGGGTATATAGGTTGAGTGCTTATGAGCATGATAATGTCGTGGACCAGGTCTGAAAACGTGCATGCTTCCCCGTGTTAACCCTGCTTGACGACTGACCA
GTGTTAATGCCACAGATCGTGTACTGGAGCACATAACGTGCTGATCATTGAACTCAGCTGACTCAGCGCCACTCTTTTCATACTCCCCCTTTGGGCAGCT
TTCTCGCGCAGCATTTTGGGTCCGTCGCTTCGGTTTATGTTGGTGTTGCTTGGTCACCTCTTGAGTCGGAAGTTTGACCTTTGATGGGGATCGTCCAGAT
ACTGCACTTGTGTTTGTGGCAGGTTTAAATTCATAGCGAGATAATTAGCAAGTGGTATCTGTACCGCTTGCTGCTTAGTGTATTAGAATGAGACCCGCTC
GGCCTCCGTTGCCGGTAGCTTCAGTTCTGTTGATTGTTAGCCAAGCTAGCTGGTGTCTCTTGTGTAGGTAGTTGTATCGACGAATTACGTTTAATAATGA
CTTAAGGTTAATCCATTGAGGTAACGCATTGACAAGTCGCTTGAATTTAGTAACCTCATCACAAACAAACAAATGTGGACACCCGTAAGTAAAATAAATA
TCAACGCTTCAAGTCTGTCCGACAAAAAGGTGCAACGTGCATCTACAGTCCTTTAAAGAATCGACTTGTGAACGAGTATACAACCGCCCAAATGGTAGTT
TGCCCAATAGTAAACAAACAAGTTCCACGACAGCTGCGAGGCGATCTACAACACAAGTGCCCGTACTAGCACTAGTGGAACGTCACCTGCTGTGGCCTAC
AACGTCTCCAGCCAAGTCAGTTAAGTAAGCGCGAACAATCTCTCGATCATGCGCTTGCATGCACCCGCACATTGTTATAGAATGTTAAACGTTACTGTTT
GCGCTAACTCTTCACGGCACTCGACTCTTTGTTTCGCATTATCAAACATTCGCACTCTTCTCGTGTTTCGCTCGAGTCTCGCTAGATCTCCATCCAACTA
GGTCCGTTTGAACAACAGAAAAAGAGGCAACTCGAGTACAAAAAGTATCGAAACATCATCCAATGTGTTTTTGCACCCGAAGTTTACTTGCCGACCTTCG
GCGCCTTTTGATTCGTTGTTTTTCACGCACTCCCTCCGTCTCATGTCCCGTCAAAAGTGTCGTGTGTGGCCTCCTTTTCCACCAATCGTGTGTCCCGACG
ATCCCGAATTCAAAGTCAAGTGGCCGCCAAGAGAGTCGATGGCGTCCGACAGCTCCGAGGAAGACGAGCCCATCGTCACGGCGCCCGCGACGACACCGTC
AAGCGATCAAAATGTACGTCCTATTCCCTCTCTCTCTTTCTCTGGTCTCGCTCGGTCTCTGGTCTCTGTCTCTGATTCGTTGTCGTTCCTTGACTCTACT
GTAGAAAACGTGGATGGACGAAGACGCCGACGAGGAAGAGGAAGATGCAGATCTGAGCCAATTGCAGCGCCAGCACTCGCCCAAGTTCAAGCGGTGTGTG
GCTGCCGTGTCCGAGAACAAGTGGGACACGGAAGCGTGGGTCACCCTCATGGACGAGGTGCAGCTGCTGCCAATTGCAGAAGCACGTGAGCACTACGAGG
CGTTTTTGGCGCAGTTTGCCACTGCTGGACGGTGGTGGAAGCTTTATGCAGCACATGAATTACGGGAGAAGCAGTACGGCCGCGTGCAGGAGATCATCAA
GAAGTCACTCATGCAGCTGCGCTGTCCCCACGTAGACC