Description :
From Genome Similarity Track
Location :
contig_1:34043- 35940
Transcript NameFunction/comments
g4.t1hypothetical protein

Sequence
1897 bases(100 bases per row)
TCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACTGAGGAGTTAGGCACGAGGTTGATCTCGTGCCAGGCACAAAGTACTGTGTGAC
CAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCATGAGTCGAAGTCTCCGCAC
ACGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCA
TCCCTCGCAAGGATGTGTTGCTGAACAACATGGCGGGCTGTGAGCTTTTTAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCG
CGACATCCCGCTCACGGCGATGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGACACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGC
TTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCG
AGGTGCATCTCGAGCACCTCCGTCGAGTGTTCATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAA
AGTTATCGGCTGCTTCGTCAGCAGCGTCGACGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATTTT
CGCAAGTGGTTGGGCCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACT
GGCGCTGGGAGAACCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGTGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAGCCATTCAG
CGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTT
AAAGCTGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACTCCTCCTGGGCTCTGAGCCCT
TTGTGATCTATACAGACCACGAGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAA
CTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACA
GATCTGTACGATCGGATACGCCTGGCATATCGAGATGATGATAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGC
TAACGCCCCGCCAACGTGCCCGACTCCGTCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCC
CAACGAAGAGGATCTGAAGTATGACATCCTTCAGGAGGCGCACGATGTGCCTTCAAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAG
GTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTT
TGCAGAGCCTGCCAGTCCCAGAAGACTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT