Description :
From Genome Similarity Track
Location :
Scaffold_1:3404- 9127
Sequence
5723 bases(100 bases per row)
AAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCG
CGCGCTTCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCGGCCACGTCGGCCATGTTGGTTGATCCAGTCTGCGTGTTCACGCTGCGAGATCACGAAATACCAGCACGCAGTTTGATAGAAATAGG
CTTGCATGTCGCCATTCTTCAAATTCACGCAGGAGTGTCATCTTTCGTCCGATGTCCTCCACATACGCTGTAACGGACTGGTTTGAACATGTCCTCACAA
GAACTCCATGTGAGACAGTTCTTGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGT
CCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGAT
GCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTT
GAGTTGATGGCAGCTCCCTGGCTGACGGATGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCG
AGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCG
AGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCAGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCG
GCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCC
TGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGC
ATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGAC
GGACTGCGGCGCCTGCTTGCGCGCTTGCCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTT
TGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGT
CGAATTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTC
GACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAA
GTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACC
AACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACC
TTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCA
AGGTGCTGTGTGACCCCGTCACAGTACCCTTCCGCTGTTGGGACCACGAGGATTCATAACACCTATTTGCTTTGCTCGTGCTAGTATCGTGTTCTTATTT
TTACTGGTTGGCCTATATAAGTAGCTTACAAGATTCAGTCTGACCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTGCTATC
TTAGCAGACGTATTGTTGTAAGAGCTTCCTAACTACATTTGCAGCTAGAGTTCACGTGGGATTGGCAACACCACATGATGCTGAATATGTGCTGGAGATG
GTTATTAGAGCTCATGTGCACTGCACTAGTAGCACAAAATACCGTATTTTATTCTTAGAATCACTAGCAACTCCTGCATAATTTTATCATAGTTTGACCC
ATGACAAGACTACGTTTGGGTAGTTACTGTACAACTTTAACCTTATTTCTTTGTGGTATTTAAATATACGATGTAGCTTATAGCATGTGAAAACATAGGT
ACAACTCCGATATTGGGTCGTACATCATTTCGATAGTCAATCGGTATCCTATGGGCACACATCGGTAGGTTTCACTGGTAAGAATTGAGCACTGACGCTG
CTTCATCCAGTCCATCATCTGTGGATGAGCTAGCCAATTCTCGATGAAGTACTTAATATTCGTAGTACGTAAGGTGAAACTTGAAAACTTGAGCCCGGCG
CTGCTCTTGGCATCACATAAAGGTTCCGTTTCAAGGCGCCCAAAACTTCTAACCCATGAAGCTACACCATTTGAGCCACTGATCCCAAGAGCGACGATAC
TGTATGCGAGATGTATCAGGTAAAGCTTTAGCTCGGAGCAGTGCACCCCAAGTTTGGAGAGTTGTCTTAAGCTCGATGGTATCTCCACCTGTGTCCACGC
AAACGACATGTCAGCAAACGAACGTGCCATTGCTTCCGATTGTCACACCCGGCTCCCTGCATCTGCCATGATGTTCTCGACTCCGGGAATATGAGCTGCA
GACGAGTAAAAGTTGTAGCGTACTTCGAGAAAGCCAATGAGCCGGAGCAGCATTTGAGAAAATGAATTTCGAGATGATCGGCGATTTGCCCATGCCACAG
CTGAAGTGTTATGGATCCAAAATCGTGTATGAGCCTAATCGTTCTGACCCGACTGCGCCCACTGAGAGACCCACCCAATTGCCGCAGATACAGCACTCAT
GAGCTCTCGAATGTTTATGCTGAACTCGTCCGATGTCGACTCGTTGCAATGTGCGATTTGTTGTAGTTCTTCCGCATCCAATATCAGTTAAATATATTCT
TTTCGAGCTGGCCAGAGCGCACACAAGCCACGGTCACTAGCGTCCATATGAATAGCACCGCATTCAACCGTCCCAAACAAAGAATTGCTGCGAACCATCT
CAGATCGTCGCGTGCTTCTTCAGATATTAACGAAGGACGATAACGAGTGGTTGTCCGAGCTAATGACGCGATCCGCTGAAAAAATTGAGTAGCCGTACGA
ACACACGTGGCCACGCGCCGTAGGCTGCCCAGTAATTTATTGAGCTGTGTTTTGGACGCCAGTTGAGCCAATTGAAGCCCATTTATCCTGTGAAGAGCTT
TTGCAATTTTGTCCTCGGGCATCAAAAGAGTCATCACATTAAGGTTCCACTGATTTCGAAGAGTCTTCCCTTCCGTAAACCACGGCGTGAATTTCTCTTT
ATTGCACGCGTTCGGGTCAAGAACTGGCGGAGACGAGCATTTCTCTGAGATCGGCGAGATCACCATCGCTGATCTCAGAGAAATGCTCGCCTCCGCCAAC
CGGGAGCCGATGTCAGGCTCAATACAAATGTGGCCATCGCACCACGCCTTGCCGTCAAACTTATCGGCGCCGGCTAAATGCCGGTCTGTCCACAGTGGAG
CGGTGTTCTTGTGTAAATGCACGGTCGCTCCACCTGCCGCCCAGTAATGTCTTGGAGCATCTGACCACCCAAACGGGCACGCCAAATCGATAATTAATAT
ACCGAGCTTTGGAGTTGTCCCGGAAAACCGACCTGCTGATTCTACAGCCACTGGAATATTGCGAAATGCACTTGCAACGTCTCCAGTGGATATTCGAGCC
GCTTCAGGAAGGTTGTGATCCACATCTAGCACCCGCCGAGCCAGTACAGCTGCACCGTCATAGGTAACCAGGATCTGAGTGCCCTCCTGAGCATGATCAT
TAACTAAGTCGCCTTTTGGACATGACAGATCGTGGATCATCCTTGCACCCACCGTGATGTCTGCATCTCCTTTATGCACTGCCCCAAATGGACTACATGT
AACTCCTTCGAGCGAAGGCAGTAAATTAATTTCGATAATCAGGTATCGGTCTTCATCTTGACCTTTCCTCAGGCTCTTGATAACTGCATTAAGAGCTCGT
AATGCAGAGCCATAATTATGTGGAGGCCGGGTTTGGCTTGAAAACGTTGTAGATAATTTTGGCCTAACGAAATGCGTCACAATGTCGCGCCATTCGTCTT
TGTACGTGTATGTTCTCCAACAAGGAATATGATCGAAAACAGTCAGGGTCTTGTTTGGACGTGGATATTGGGAGGTTTCTCCGCAAACCAATCGAATAAG
GTCGAGAGGCCCATTTTCTACCGTCGAAGTAGCGCGCTGTACGCATACTGCTTGGTCCGGTCAATCTGGTATAACCTCGCTCCATTCTTCACAACCCAAG
CCGGCGAATCCGTTGGTGGAACCACTCCATAGTGCTTCATGATCGAGGCGAGACCATCTCGCGCGCGGTGGCGCTGAAGGCCTAACATTCTCTCACTTGC
TAGGAGCGTCAGCGTGTAGCGGCGCTGTTGACCCGTCAGGAATATTTGAAGTTCCCCTGACACGACAGTCCGCATCTCATGTCCACGCTCCTTTCTGCCC
ACGCCGTGGCAACGAGATTCATTAGACCCCTGAACCGACTTGCAATTACTTTGCAACGGTACAACATCCCGCCCTTTGGGGATTAAATCCTCGTTGGGCC
AACCGACCGACCTGCAATTCTTATGCAGCGGCAAAACAACGCCCAAAGCGTGAGCCTGAGTCACGTAGGGCCGACTCACCTGACTGCACCCCTGATGCAG
CGACAGACCAGAGCCAACTTCGTGAGCTTGCGTCCCGTTGAGCCCCTCGACATGGATGCAATTGCTATGTGGCATCAATCCATCCGTGTATGTGCTTTTC
TTTGGCCTCACTGCATGGGTATTTGACAGTTTGTCCTGCGCTAATCTGCAGCTCCCTGTCCTTGTATCGCCCGAGCCGGACTTCACTATTAGTGGAGGCT
GCTCAATCGGCCTGAGGATGGTTGCCATCCGGCCCACCTCATGGCTCCTTCACACCTCCGCTTGGCTGCCTGTCGCTGGTGCATTTGTGTCCCGAAGCCC
CCCCCCGTAGCTTTTACTAATGAAGTTTCTCACAGTAACTGGTAATTTAGCAGGTACGAAGTGTCCTCGGTAGTCGAACACACAAGTGTCTCCTTACCAG
GGCATCCTTCGATAGACAAAACCTTCATGCACAGCTTCTTGCCTTAACGAATCGGAAGCGCTGCCACCACCTCCGGGGGAACGGGAACTCGGCGTTCTTG
TCGGGCACCGCTGTTTGTTGTGCGCGCTTTGGCTTTCTTCATGCGAGACGATGGTTTTGTGGGGGGGGGGGCGGTGACAACTTTAAAGCTGCTTCCACCT
TGAGGCTGGTGACACGTTAATCC