Description :
From Genome Similarity Track
Location :
Scaffold_232:3404- 5125
Transcript NameFunction/comments
Phymu_g7222hypothetical protein

Sequence
1721 bases(100 bases per row)
TTCGGAGCGGAGAGGGTCGTCATCTCGCCCGTCGCTGTCGTGGTGCTTGCGTTCGTGCCTGCCGTAGTCGTTCCAGTACTGGGTTGTGTCGCTGGGACCG
TCTCTCCGCGGTTATTCTGGGAGTCGGTTCCTTCCACATTCTGGTTCTCACCGTCACCCTCGTCTCCGTTCATCTTTTCGCCGCCTGGACCCTCGTGTCT
TGGATGGGCACCGTCATCACCGTTCCCACCGTCGTCCTCGGGAGGGGCTTCCGCCCGTTGCACTTGCTGAGTGGGTGCCAGCTCGCTCATTGGGATCGCC
GTCGTCCTTTTCGCGGTTTGCTTTTTCTGTGTTTgttctgctgttgccgtGTCCATTCTCGTACGAGACatgtcgtcgttctcgtttTCTTGACAACGCC
CCTGTATGACCCCAGTGTAACGTGTCTCTTTGACTGCACGCCGGGTTTGGTCGACCAGTGCTGAATTGGTCCGAGTATCCGTTGGCTTTCGGTAGCCGAA
CTTCCGCTACCCCGCCGGCGTGTACCCTACTGACACACTACCTATTTGTATATCCGTTCGTTTAGTGTAGACTAAAAGCAGCTAGCTAGGCTGCTAATAA
ATCCTACTTCTGTCCGTCTCACGCCAATTGAGTCGTCGCCCGATCACCACTTGGACACTACGCCGTGTGCGCCTTGCCCTTCGTCGAACGCAGTCACCAG
TTGACAAGAAGACCGTCGTCTCCTACTCGTAATCTACGTGAGCCGTCCAGCCGTTCCGTCCGTCCAGCCAATTTCCAGTACACGCCCACCGAATTGCGTC
TGTGTTACCAGTCCGTCCGCCCGCTCGTCAAGTTCGAGTCCGTGTACACCGGATGTGCACCGTACTCGCCGTCCGTCCTTCAGTTCGCCCGCTCTCCAGC
CAGCCTGTGTGGagaagtgcgaataagattttccgagaaaggcaatgtcggccaccagaTCATGAGATAGACCCAGATCGAGCCACAGGGGCAACACCCC
AGTCGAGATGTCAGGTTGACAACTTGTGATCCCCCACCCGGCGGCTATATGGAGAGACTTGGACCTCGGATCACTTAATGGACACCAGATTGAAGTTGGA
AACGGATGgaaagaagctgccgagttCCAGATGTGACGATCCGGGACGAAGGAACCGGGACCTGCGTGGAATCCAGGCCCAGGCTGGTGAACGGAGCGTG
GAGGTGAAGATCCACAGTCAGGGAGCCAGGATCCAGCGGGcatggacaagatcacggCATAATTCAGCGGAACATTATCGGGGTAACTGGAATCGGCTCG
GACTGCCCAAGACTGGAGCTCAGCCACGCCGATCCAGGAACGAGAGTGCCAGCTGGAGGCCGATATGAGTTATGTCCGGCGTACACGGCCGTCGCGGAAG
AGACCAGAAGAGGACAAGTGTCGCCGCTCCGAGATCCGGGCCGATCGAAGGAAGACCATACCGATCGCGACCAAGGCGGTGCGGTTCAAGGTCGTGCTGA
TCGCTATCAAGGAGTGccgatcgcgatcgaggacCTTCATGCGGATCACGATCGAGGAAGTTCACATAGATCGTGATCGAGTAATGTCGATCATAATCGA
GGGGTAGGTGAGATCGCGATCGATGATCGATGATTGCGTGAACCTGTTGTGTATCAGGtgtcaggtgatcgtagGATAGTGAATCAGGATGAGACTAGTG
GCCATAGGGATAACTCTAAAC