Description :
From Genome Similarity Track
Location :
Scaffold_14:340392- 346462
Transcript NameFunction/comments
Physo_131074reverse transcriptase
Physo_131075hypothetical protein

Sequence
6070 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATG
GAGCACTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTGTGTCCTTGCTGGGCCCGGAGGGCGTGACGCAACTTACGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACTGCCGCGGCGCCCCAAGC
GCCCCCTTCGTCGTCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGAAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGCGGGCGAGCGAGAGAGTGGC
ACTAACGTCCGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTCGCTCCGCCTAATGAGGCGTATCGC
GTGCGCTCACGCTTCCTGGCTACTCGGCAGAGCAAGAAGGAGTTGATGGACTACGTCCAAGAGCTGAGAACTCTCATTGCAGGGATGTCTGCTGACCCGT
TGTCACCGTTACGGTGTTCATGGAGGGCCTCCGCACTGGCGTTGCCAGGACTGAGGTGTTCCGAACGCACCCGAGCTCTTTTGAAGAGGCTGTGAGCGTC
GCATTGAATGCGGAACACAACTTTAAGTCGTCGCGACTTGGGGGAATGCGTCTTACGCTAGCGCGTCGAATGGTCCGGAACCCATGGACCTCAGCTATGC
TGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTGTCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGGGTGTCCG
CTGCGTCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTTGAGCCAGGGCTCTGGTTCGTCTCGGGGAAACGAGAAGTCCCAGTAGGCCGCCCCGC
GCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGTGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACACGGAACGTGTA
TGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACAAAGCCATAGACGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCGGC
ATTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCACTGTTCGTCTCGCGACGGGCACTCGTGTCACGGT
GCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTACCTCGATTCGAGATATGATCTCATCCTTGGTATGGCGT
GGCTGGAACGCCACGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTGGCGAGTCATGAACCCACCTC
TGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTGGTGGACACTGAGTGTGTCGAG
AACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGAGCGGCACGAATTCCGCTGAGCGGGTGTGCGCCTGAGGGCGACGCCCTGCTGTATTCGAGTG
AAGACAAGGTCGGCATGAAGCCGAGGAGCCATGGGCGCGGCCCGGCTGTTGAAGGATGTGGAGCGGCACTAATTCCGCTGAGCGGGTGTGCGTCTGAGGG
CGACGCCCTGCTGCGTGCCGGTGAAGGCGCGGTCGACAGGAAGTCGAGTGAAGATGGGCGTTGCCCGGATCAAGGATGTGGAGCGGCACTAATTCCGCTG
AGCGGGCGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCGCGGCCGGCGCGATGCCGATGGACAAGGGGCTTTGCCCGAATGAAGATCGTG
GCGTGGCACGTAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGT
GACACCTGACGTCAAGACGCATGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGCGACGC
AAGGCGCCTGCGATCTCACGAGTCGAGAAGGGCGTGTCAAGCGGTGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCG
ACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTGTCCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGC
TGGAGACTTGGCTGAGGTAGTGGTCATACGACCAGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTG
AATGCGCGGAGCGGATCGGCGATCCTGAAAGTCCCGTCGGATCCCTTGTATCAAGCGGTAAAGGAATACCAGGACGTGGTCTCGAAGGAGCCGCCCTCCG
GATCGAGGTGTTCGATACGAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACG
CGTTCTTCAGTGCAAAGCACGAGGCGGGTATGGTGCGTGAGAGTAAGTCTCCACGCTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCG
TATCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACG
ATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCCGAGCAGCATGCTCT
GGGAGTGGTTGGTGATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAAC
GTACTTCGATGACAGCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGGAGAACTATATGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGT
AAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACC
CGGTCAAGGTCAAGGCCATTGTTGACTGGCAGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTCGGCTTGGCCAATTACTTGCACAAGTACAGCGA
GAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGGACACCGAGCATCAAGATGCGTTCGCGGCCATTAAG
GACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGCCATCGGTTGTGCACTGC
TGCAAGTAGACGCCGAGGGGCGCGAGCGCGTGGCGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACT
TGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTTGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAG
TCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAACCGGCAGGCACAATGTCCTTGCGGA
CGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACT
TGTGTCGCGTTGCTAAAGGCTCCGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGTTACACCGTTATTCCCTCG
ATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTAAAGTACCGCATCCTCTATGAGGCACA
TGACACGCCGCTGGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGAGCACTTAT
GTGCGCACGTGCGAGACGTGTCAGAGAGTGAAGTCGTCACCTCATGCCGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGAGCTGCTGGCAATCCATGA
GTATGGACCTTGTGTTTGGCCTGCCGGCGAACGCGGCGGGCAACACAGGAGTCGTAGTCTTCGCGGACCGACTGAGCAAGATGGCTCACGTTGCGGCTGT
GCCGGATACCATCGATGGTAAAGGTACAGCGACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGGCGATTGTCTCGGACCGAGACCCC
CGCTTCACGGGCAACTTCTGGAGCGCGGTCTTTGCAGTGCTTGGCATCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACAGAGC
GCGTGAATCGCGTCGCCGAGGACGTGCTCCGCAGCATTTGCGCCGAAACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTTATTTTGCGTTGAACAA
CGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGT
GGGGGAGGAGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCT
TACGACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAGCATGCAGATGTCAGGGGCACAGGCAATGCTGAAAGTTATGAGGTCGGGGA
CCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAAGTTACGCCCGCGACTCATCGGACCTTTCAAGGTTGTG
GTCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGGCGCACCCCGTCTACTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGA
AGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACAGGCGCGGAAGCCGCGGTCGTCGAGGAAGCAGTCGCAGGCGTCGAGGACGCGGCCATCCACGTG
GGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCAGCAGTCGGAGCCTGCATGCGGG
CCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCGGCCAAGCTGCTCATCGCGATCGCGATAGTATCGCACCCA
GTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGAACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGACCCAGA
CGCGCATCAACGTCATGGATATGATCCCGAAGGCGATCTGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCA
CCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGCCAAAACCAGTATCTGGTGAAATGGC
GAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGT