Description :
From Genome Similarity Track
Location :
contig_22:340251- 343339
Transcript NameFunction/comments
g5919.t1hypothetical protein

Sequence
3088 bases(100 bases per row)
GCGCTCGCGTTGATGCCTGGAATGCCCGCGCTGTCTGGGAAATTGTAGCCGCAGGGCGGTGGCATCGCTTGTGGCACGGTGGAGCAGCAACTTCCGCCGC
CTGCACTACCAGTGCATGAAGCAACTGCAACCACAGCAGTCCATGCCGTCTCCTCACCGCATTCACAACCCCCGCGATCACAGCCACCACAGTCGGCCAT
TTGTGTCTGAAAAAGAATGTGGAAGCTGGAGTGTTTAAGTATGAATTGCCATGGGTGGCGTGAGTCAGTGCTTTGGAGTCCGAGTTCATGATCACTCCTC
AACTTGCCGCTGAACGGGAAACTAACTAACTATCCAACGCAACGACCGTGCACGACGCGCCTCCCCTGTAACCCGTGCGAAGAAGACTCACAATTAACTG
AGACTGCAAGGCAACTTCAACTCGCTCCCGCTGCAGCTGAAGACCGCACGGCCTGCTGCCGGTACGGTGGAGGCAACGACCGAGCCATCACCGCCACGTT
GTGTACGTGCAACCTGTTGCAGTCCGCCTCCGCATCTCACTACTAAGCGGACAGTGTGATCAAGCAAGAACAGAGGCGAATATTTCCTATCCAAGCATCG
AGACTAGGATACTTTGTCTCCGTCAATTAGGTTGTTGTCTCGGTAGCGAAGATACAGCACCAATAGATTTTGAAACCATGCACTGCGACAGCAGAACGCT
CTCGGAAGCGAACGAGTGTGGTGATGCATGTATTAAGACGGTGTCCAGGCATGAAGGTTGCCTATGAACCACGTCAACCAATGCTTTTAGCCGACCATCG
ATCACTCACCGCTCGATCATCAGTGTTGTAGAGTCTACAAAAACTGCGCGACTCATGTCTCGCCCTGGTCAGACGTCACAGATGCTTGTGATCGGCACCA
CGCTGAAAATCCATACGTTTGCTCCGGCTCATTTGCACGTCCACCCTGATCTGCGGTCTCCCATTCCCCAATCCGCCCTCAAACACCGAAGTGCCAACAC
CGGCAACTAAGTAAGGCAACGATGTGCATTCCCTGCTGCTGCGACGACGGTCCTCCGGGACCCGATGGCGGCTGCTGCGACCCGTGCGGACCGTGCTGCG
GTGATTGTGGCGGTTGCTGCGGAGACTTGGACTGCTGCCTCTGCGGAGCTTTGACCGCTTGCTGCTGCTGCGGTGGCGGAGATCGCGGCCGCCATGACCG
AGGCCCTCCGCCCGAGCGCGTCGTCTACGTGGAGCCTGTCGTCGTCCAGGGAGGACCCCCGCCACACCGCGGCTACTACTAAGCCCAGGGGTCAACCGAC
CGACAGAGCAAGAACAACGACCAAGCAAACCCCAGTTACGTGAGCTCACCGCCGTACGTGTAAATTAGAGCGGAAGCTTCCGAGCAATGGAACGAAATAT
ATCCTTGAAACCTTCAACCTCAGCATCGAATTTGACGTTTGGCTGGTATGTGTACTTCGAGTTGCTGGAGCTTGTGTCGCAGCAGCTTCCCGACGAATTT
CGGGATGGCATCTTTCTTGTAAAGGTACAACCGGCTCGGTTACGTAGGCCACGATCTCCACAGGTGTCGGTGCGGTGGGATTGTTCGACCTGGTGTACAA
GTAATCTATCCGGATTTGACATTGTTGAAATGCTCACTCACCCATACGACGAGTACTCAAGACTACGGCTGAATTGTTTGATTTTACTTCTCAAAACTCA
TAGATAGCAGTGCGCTGGTCGAGGCGGGAGGTTCACTCGCGAGTTGTGCAGCAGTCTCGGGAGTCGGTGGATGCCTGCACTCCCTTCCGTCGCGTCCCCA
CTGTACTGGTTGTCGTCTTCTGAGAGGAAGACTCGGTAGACGAACGTCGGCACTGCCAGCTGCAAATCCAAGTCTCCGAGTCGCTCCAACCTGAACGTGG
CGTCTTGTGACAACGGTTGCAGCACCCGCAGCACTAGGTCATTTTCTAGTTTATTGTGTTTCATTGGCGCAACACTTTCACTCTCCGACGAAGAGCTAGA
AAACTCCTCTTCAATAGAGTGGGGCACCCATTGCGTCCCTCTCACGTCTTTAACCTTGCTTTTATCAGGTTGTTGCTCTGGCAAGCGGCAACTTTCTCTG
GACCTCGCACTGCCGAGGTCGATGGTCACGCAATCCGTTTCAACGTCCTCGGCAGCGCGAATCTCGGCGTGCTTGAGACTCTGGCGCCTCATTCGCGCGT
GCATTTGCGACTCGAAGACGTTGCGCACCGCCTTTTCGCGCTCCTCCTGCCGCCACTGGCGCCTTCTCCGGATCATGGCCCGAGGCACCAGGAAGGCGAA
CGCCTCCCGCTGCTCGATGTAGCTGAGCACCACTTTTGCCTCGTTGCAAAAGGAAGCGGAGGCGCGGGGCCTGCGCGTCGGGTTTTGCACTGCCGCTAGC
TCTGCGTAGGGTGCTGCGTAAATTGCTGGCAATGACCGAGGGCTGCCTTTGTTCAGTCAAATTTGAGAGGAAACCTTCGCGCTTCAACACAGCCTGGGTG
GCTCGGGAGAAGCTACACTTTCTATTGTGTGGTGCACACAAACATCCACTGGGTGGCACGGTTCGCCCATCATCAAAACATTCGGTTCACCTTAGTGAAG
TCAAGTGTGCGCGCGTCACAGATCACAGCTGGCGAAAACGCGTTGGACAAGTGTGCGGAATATCCAACGGCTAAAGTCTCCGTAAGTCGGCGGGAGCTCC
TCATTCTTCAATTTGCCACGTTGCACCCAAGCCCAAACCACCTCCAGTCATGTGCATCCCCATCTGCCTCCCATGTGACGACATGGCCTGCTGCCTCTGC
GGTTCAGTCACTGCGTGCTGCTGTTGCGGAGGCGGCAACGACCGTCGCGACGACTACAACCGCCGCCCTCCCCCGCCGCAGCGCGTCGTCTACGTGCAGC
CAGTGGTCGTCCAGCAAGGGCCTCCGCGTCACCGTCACGGTCGCTACTAAGTGACAACTAGACCAGGGCGAGCAACAAACTCAAGACAACCAAGAATCGA
CTTGTGGTGCAGCGAACCTCCAACCGTTTCGAAAGACCCAACGGCGGATTGATGACGAACGCAACCGTTTCCATCTACAGGATAATAC