Description :
From Genome Similarity Track
Location :
contig_22:340226- 343314
Transcript NameFunction/comments
g5634.t1RAW36412.1 hypothetical protein PC110_g7320 [Phytophthora cactorum

Sequence
3088 bases(100 bases per row)
GATGGTGCGCTCGCGTTGATGCCTGGAATGCCTGCGCTGTCTGGGAAATTGTAGCCGCAGGGCGGTGGCATCGCTTGTGGCACGGTGGAGCAGCAACTTC
CGCCGCCTGCACTGCCAGTGCATGAAGCAACTGCAACCACAGCAGTCCATGCCGTCTCCTCACCGCATTCACAACCCCCGTGATCACAGCCACCACAGTC
GGCCATTTGTGTCTGAAAAAGAATGTGGAAGCTGGAGTGTTTAAGTATGAATTACCATGAGTGGCGTGAGTCAGTGCTTTGGAGTCCGACTTCATGATCA
CTCCTCAACTTGCCGCTGAACGGGAAACTAACTAACTATCCAACGCAACGACCGTGCACGACGCGCCTCCCCTGTAACCCGTGCGAAGAAGACTCACAAT
TAACTGAGACTGCAAGGCAACTTCAACTCGCTCCCGCTGCAGCTGAAGACCGCACGGCCTGCTGCCGGTACGGTGGAGGCAACGACCGAGCCATTACCGC
CACGTTGTGTACGTGCAACCTGTTGCAGTCCGCCTCCGCATCTCACTACTAAGCGGACAGTGTGATCAAGCAAGAACAGAGGCGAATATTTCCTATCCAA
GCATCGAGACTAGGATACTTTGTCTCCGTCAATTAGGTTGTTGTCTCGGTAGCGAAGATACAGCACCAATAGATTTTGAAACCATGCACTGCGACAGCAG
AACGCTCTCGGAAGCGAACGAGTGTGGTGATACATTTATTAAGACGGTGTCCAGGCATGAAGGTTGCCTATGAACCACGTCAACCAATGCTTTTAGCCGA
CCATCGATCACTCACCGCTCGATCATCAGTGTTGTAGAGTCTACAAAAACTGCGCGACTCATGTCTCGCCCTGGTCAGACGTCACAGATGCTTGTGATCG
GCACCACGCTGAAAATCCATACGTTTGCTCCGGCTCATTTGCACGTCCACCCTGATCTGCGGTCTCCCATTCCCCAATCCGCCCTCAAACACCGAAGTGC
CAACACCGGCAACTAAGTAAGGCAACGATGTGCATTCCCTGCTGCTGCGACGATGGTCCTCCGGGACCCGATGGCGGCTGCTGCGACCCGTGCGGACCGT
GCTGCGGTGATTGTGGCGGTTGCTGCGGAGACTTGGACTGCTGCCTCTGCGGAGCTTTGACCGCTTGCTGCTGCTGCGGTGGCGGAGATCGCGGCCGCCA
TGACCGAGGCCCTCCGCCCGAGCGCGTCGTCTACGTGGAGCCTGTCGTCGTCCAGGGAGGACCCCCGCCACACCGCGGCTACTACTAAGCCCAGGGGTCA
ACCGACCGACAGAGCAAGAACAACGACCAAGCAAACCCCAGTTACGTGAGCTCACCGCCGTACGTGTAAATTAGAGCGGAAGCTTCCGAGCAATGGAACG
AAATATATCCTTGAAACCTTCAACCTCAGCATCGAATTTGACGTTTGGCTGGTATGTGTACTTCGAGTTGCTGGAGCTTGTGTCGCAGCAGCTTCCCGAC
GAATTTCGGGATGGCATCTTTCTTGTAAAGGTACAACCGGCTCGGTTACGTAGGCCACGATCTCCACAGGTGTCGGTGCGGTGGGATTGTTCGACCTGGT
GTACAAGTAATCTATCCGGATTTGATATTGTTGAAATGCTCACTCACCCATACGACGAGTACTCAAGACTACGGCTGAATTGTTTGATTTTACTTCTCAA
AACTCATAGATAGCAGTGCGCTGGTCGAGGCGGGAGGTTCACTCGCGAGTTGTGCAGCAGTCTCGGGAGTCGGTGGATGCCTGCACTCCCTTCCGTCGCG
TCCCCACTGTACTGGTTGTCGTCTTCTGAGAGGAAGACTCGGTAGACGAACGTCGGCACTGCCAGCTGCAAATCCAAGTCTCCGAGTCGCTCCAACCTGA
ACGTGGCGTCTTGTGACAACGGTTGCAGCACCCGCAGCACTAGGTCATTTTCTAGTTTATTGTGTTTCATTGGCGCAACACTTTCACTCTCCGACGAAGA
GCTAGAAAACTCCTCTTCAATAGAGTGGGGCACCCATTGCGTCCCTCTCACGTCTTTAACCTTGCTTTTATCAGGTTGTTGCTCTGGCAAGCGGCAACTT
TCTCTGGACCTCGCACTGCCGAGGTCGATGGTCACGCAATCCGTTTCAACGTCCTCGGCAGCGCGAATCTCGGCGTGCTTGAGACTCTGGCGCCTCATTC
GCGCGTGCATTTGCGACTCGAAGACGTTGCGCACCGCCTTTTCGCGCTCCTCCTGCCGCCACTGGCGCCTTCTCCGGATCATGGCCCGAGGCACCAGGAA
GGCGAACGCCTCCCGCTGCTCGATGTAGCTGAGCACCACTTTTGCCTCGTTGCAAAAGGAAGCGGAGGCGCGGGGCCTGCGCGTCGGGTTTTGCACTGCC
GCTAGCTCTGCGTAGGGTGCTGCGTAAATTGCTGGCAATGACCGAGGGCTGCCTTTGTTCAGTCAAATTTGAGAGGAAACCTTCGCGCTTCAACACAGCC
TGGGTGGCTCGGGAGAAGCTACACTTTCTATTGTGTGGTGCACACAAACATCCACTGGGTGGCACGGTTCGCCCATCATCAAAACATTCGGTTCACCTTA
GTGAAGTCAAGTGTGCGCGCGTCACAGATCACAGCTGGCGAAAACGCGTTGGACAAGTGTGCGGAATATCCAACGGCTAAAGTCTCCGTAAGTCGGCGGG
AGCTCCTCATTCTTCAATTTGCCACGTTGCACCCAAGCCCAAACCACCTCCAGTCATGTGCATCCCCATCTGCCTCCCGTGTGACGACATGGCCTGCTGC
CTCTGCGGTTCAGTCACTGCGTGCTGCTGTTGCGGAGGCGGCAACGACCGTCGCGACGACTACAACCGCCGCCCTCCCCCGCCGCAGCGCGTCGTCTACG
TGCAGCCAGTGGTCGTCCAGCAAGGGCCTCCGCGTCACCGTCACGGTCGCTACTAAGTGACAACTAGACCAGGGCGAGCAACAAACTCAAGACAACCAAG
AATCGACTTGTGGTGCAGCGAACCTCCAACCGTTTCGAAAGACCCAACGGCGGATTGATGACGAACGCAACCGTTTCCATCTACAGGA