Description :
From Genome Similarity Track
Location :
contig_6:340164- 341524
Transcript NameFunction/comments
g1830.t1Major Facilitator Superfamily (MFS) transporter
g1831.t1Major Facilitator Superfamily (MFS)

Sequence
1360 bases(100 bases per row)
TTTCTACAGCATGCCGTGTTAGAGGAATGAGCATGGTCTCGAGGGCGAGACCGCACGTATACACCAGCGCTGCCGCCACGAAGCACAGTCGGTATCCGTA
AGCCTCCACGATCATTCCACCGAGTACGGCGCTACCTGCCCAAGAGGCAACAGTCAGTCCCTCCAGCGAATTCCAACGCGCACGATGCGTCTTGGGCACG
AAATCCATGAGAAGTGATCGCCGGAGTGGTTCCGTGCACTGCATCAACGCTCCGTGCGCTAGGAACAGCACACTCTGGTCGGTCACGTCGTGCGAGACTG
CCATCAGCAGCAAACTGATGGTGCCAAGTGCACGCGTGGCCACGACCATGGCATTCGCCCAGTAGCGCTCGACACCATTTGCGCTAGGAGCGACAGCAGT
GCAATCACCAGTGGCTGCAGTGCGAAGAGGGTCTGCACTCGAACCGGAGACAGCGCGTACTCGTTGAGAAAGAAGAGCGGGAAGAACGCCGTGACAAGTC
CGGTGCCGTTGCTCACAAGGAAGTCCGACACAAACAGCAGGTACGGGACGTGCGCAGTGTCGAGCATCCCGCAACACGCCATGACGGGGCGTACCGGGAC
ATCCTCGCCATCGTCACTCCGCACTGGAGCAGCCAAGTAGTAGCCGCTGGTTACTGAAGGAACCCTTGAAGACCGGAGAAGTTGAGAGAACTCGCTTGTC
GAGGGCATGTGCACACGAGAAAAGCTCCCTCCTCGTTCGGAGGCGGAGCTTTCTCTCTCGCTGTACTCGGATGTGAAGTTGCGCTCGATGGAGCTCAGTC
GCGCTCGATAGCGAACACGTACTGCCGGTTCTCAAATGCTAGGTCGTCGTTGAACTGAAACAGCACGACCATGGACACTGCCGCGATGAACGCTCCGAAA
AGCAGAACGGGTCGCAGTGCTGCAAGCGTCCACGCATCACCGTGCTTCCATAGCAACAGCATCGCACTCAAAGGCCCGAGCACAAGCGCGACGTTGCGCA
TGACGTACTTCAGCGTGAACGGCGCTGATCTTTGCCCTACCGGCACCGAGTCAGCGAACAGAGCCTCCATGGCCGAGCTCTGGAAGGCAGCGAAGGCCCC
CCATAGTCCGAAAGCCACGTAAATGAGGACCATGTCGCCTAACTCGAAAGCCAACGCTGTCAGCACCGAAGCCACGACGCCGAGAACGCCTGAAAGCGCG
AGGATCCGGTCTCGACGTGTACTGTCCGCTGCATAACCAGCTGGGAATGCGCACAGTAGCTGGGCTAGACCCTGAATGCCCTTGACGAAGCCCACAGGGA
CGTTGGAAGCCGTCAACACGTACACGTAGCCCGATAGCACCTGCTGCGAAATAATACTAC