Description :
From Genome Similarity Track
Location :
Scaffold_670:3401- 7465
Sequence
4064 bases(100 bases per row)
CTTTCTGACACCCACATATCCCGCGATTTTTGGATTCCGGGGTATCGCAATCGGGTTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGAAGGA
ATGAGCCTGATCAGCGTATCGGAGCTAGACATAGATTTGTTCTATCATCACTTTTCAAAGCCCAATGGATACATCTTCCCGGTCCAACTGGGCAAACTTC
GCCCTCCTCCGGAGTCGTCCTGGTCATCCCAGCTTTGATCATGTCGACTAAGATTGAACAATTTTACGATCAACAACCTTGGAACCATTATGATCAAACC
ATACACCCGATCTCGTTAAGCCTTCTGGCTGGTTCGAAAAACTGGTCGAGGCGTATGAAGTTATCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGAC
TCATTTCTTGTGGATCTCCGCTGAGCACCGTAAAACGGATCCTGGATTGGTCGCTATTGCGCGAGCGAGAAGGCAGAGAAGATCTCGTGCTGGTCCCTGT
TGGAAGCGGGTACTGCAGCTGATTCTTCAAGGCATGATCGACGGCCTCTGCGATTTGGACATTTTACTGGACTTCATCTTTCTACACTTTCCCCGTCAGA
ATGAGGCTAGGGCGTGGTATCCCGGCCTATCCGTGCGGCGGACCAACATACCCAACTAGATCACTGCTTTGTCGATCGATCACGCTACCGAGCGTTGGAG
GAACCAGTTTCTTCCTTCGATAGCATCCCACCCTGGGTCGTCTCTTCCACGCTTGGTGGGTAAGTTCTTTGACCGCGAGTAATTTACTTGGTCTGTTCCA
TGACGCGATCTCTCAATATACTTTCTTCTCATTTCCATTCGATCGCTCCCATGAATCGTATTTCTTCCATCTTTTTTTTCTTTTCATCTTGATCGCACCA
TTAAGTCTGCGATCGTCGCACTCACTTCACATAAATCTCATTCCACCTCTATGTGCAACCTCCTTGCACCCATAACTCTCCTTCCTGTCCATGCACCGTC
CCTGCATAGACCCATTCACTCAAGCTCTCCTATCATCGCCAATCTCTAGCTTCTTCTTCGTGCGATTACATCACCTCAAAACGATCCTTGCTCACCTGAT
CACGATCGAACTCCTGCAACATGACTCCACAATTTAGATCAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGGTACTGCTTGTG
TATTCGGCCATATTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCGAACTCGTCCGCGTCGATATTACCCTCCCAACTGACTTCCGGCA
GCAGTGTTTCATCAAAAATCAAACCGACTGGCCTTATCCACACTCAACCCACCCGTTGGGCGTTCTGGGAATACGCGAACTAGCTTCAGCTTAGACACGT
GGACTATTAGGAATAGCCGGTACGGCGTGCCCGCGATATCCAGCTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATG
GGCTAGCTTTCGAGCATATCCTTTCTTGACTCGGTTCAGATATAGCCAAACTTGCGACCCGCGATCGATATCCAATAAATCTGGATTTTTTTACGTCGAT
CGGCCCGAACTCTGATCGCAGCCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACAATATCTCCATCTTCGGGCATCTTG
ATCCCGGGGTTTGGTACTTCTCAACGGTAAGGTTGCTTCTAAGGTCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGA
TCATGAGCGGTGTTGATCGCATAAGTCAATCGCTCTGCGTATCAGTCCCAGTCCTTTTAATTTTCATCCATGACATACATCTTGATCGATCGGGTCAGCG
TCTGCACCATGCGTTCGGCCGTACCATTAGCTTGCGGTCTATACGCAAGAGTGGCCCGTTGTTTTTGTTCCGCGATCCAATGGAATGCTTGGAAGAAATC
AGACATAAATCCCGGCTCGCGATCATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTCCTCATAATTCTCTGCGATCCTCTGGGCAGAT
CTGGATGAGCTTGCTTTTGCGATCACATATCCAGAGAACAAATCGACCCACAGCAATTGCTCGGTGTTTCCTCAAAAGGATCTTGGCAACAAAGGGATAT
GATCCATAGCTATAATCTGAAAGAGTACGTTGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCTCATTTCACAATCTACACAC
TCTCCCACATACCGCTGCACACTTCTGTACAACCCACGCCAATGTAAATTCGCTCTGATCCGTTGATAGGTACGGCCGATTTCTCGGTGAACACCCTCCA
AACTTGTGTGGTAGTGGTGCAAGAAGTCTATCTGTAACTGTTCTGGAAGTATCAAACGAGCCAGTTCAGTGCGATCTTCAGCTTCGGTAGCCGATATCGG
ACAGAAAAATAGCAGCCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCGCACCTTAGCTTCAGCCACCGATAACTTAGCTACGTCTCCAAGC
AGATATACCTTCAAATTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCCGCTGCACAACATCTTCCTGTAAAATTCTGG
GCTGACATCGTCTTCTCTAACGTGTTCGAGTGATAGCCGCTACTTTGACTGCACGATCAACTCGTTCAGGTAGTAGTAAATCGTTTAACCTATTGAGAGT
AATCAGGTCCTGACGCTCTTGATCGAAAACCACACCTTTTCCATTCTCTTTCCGTAGAGCTTCACTCGCCAATCAATCTGCACGCTGATTCCAGTCCCGC
TTCATGTGCAAGAACTCGTGGGACGGCCACGATCTTAATCTCTCCATAGCCCTATGCCTCAACAACTGCAGTCCCGGTGCTTTACAGTCGATTTCTTCTC
GCATTTGACGGATCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCGGATCGGCAAGCAATCGAAACTAAGGAGCAGCTCTCGGTATTCT
GCTTCATTCACGGTTAGATCAGGGGTATACTCGGAAGCGGCAGGCACAATTGTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCCCTTTC
TTTTCACACTGGCTGATCCATCGAAACTGGCTACCAGCAGTTTTCATTCACACCTACTGTGGGTGGTGGCATTCTTATCGTCTGTCTTGGCTGCTTCCTC
GGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAGATCGCCTAA
TTTCCAACGTCCAGCCCATCTTCCCAATCTTCTGTTGAGGCCTGAACATTGTAGTAACCATGCTAGTGTCGAATATCGCGTAAGCACCGTAATCTCACGG
GATTCTAGCATAGTATAGCAGATATCTAGCATCCGGAGGAGAGCCAACACTTCTTGCTCCACCATCCCGTAGTTGCCCTCGTTGGGCTTTAGCGTACGAC
TGGAGAAAGTGACAAGCCAATACACACCATCATATTCTTGAAGCAAAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATCGATC
GGGATCGAAATGCTTTAAGATTGAAGTTGTGGCTATCTTAGCCTTTAGCAACGTCAACGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCGGGATCG
CGATCGTCCCCTGCAATTGGGTACCGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATCGACCCCTGCACTCCCTTCGTGAATAGCATCAGGTC
TTAAAGCAGAGGTATGTTTTGGAGCTTCACTCACGCGGTTGATCCCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCGTAAACTGCAAAGTC
TTCAATGAATCTACTGTAATAGTTGAGCCTTCACAAGAAATAACTGCATCTCTCACAGCGCCCG