Description :
From Genome Similarity Track
Location :
Scaffold_29:34007- 37269
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.10Glucan 1,3-beta-glucosidase
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.11General transcription factor IIH subunit
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.12Tryptophan synthase

Sequence
3262 bases(100 bases per row)
GGGATCCGAGCAAGTGCAAGTCCGCGGCCACGATCGCTGCCGACCTCAAGGTGCTCAAGACCATCACGACCAACGTGCGTACGTACTCGCTCTCGGACTG
TGACGTCGCGCCCCTGCTCACGGCCGCCAAGTCGCTCGGCCTCACCGTCTGGCTCGGCGTCTGGGTCTCGGCCGACACGTCCGTGTACGACAGCGAGGTC
GCCGCGCTCAAGAAGCTCATCCAGGCCAAGCTCATCGACTCCAACGTCGTGGGCTTCAACGTCGGCAGCGAAGCTGTTTATCGCAAGGACATCACGGCGG
AGAAGTCGATCGAGTACCTCAAGGACTTCAAGAGCGTGCTCACAAAGAACAGCATCACGGCGCCCGTGTCCATCACGGACATCGTCGACATCCTCACGCA
GTACCCCGACATGATCGCTGCCGGCGACGTCGTCACGACCAACCAGTTCCCGTTCTGGGAAAAGATGGAGCCATCGAAGGCTGTTGCCCAGTTCAAGACC
CGTATCCAGCCGCTGATCAACCTGGCGGCCGGCAAGGAGTTGATTATCAGTGAGACTGGCTGGTCCACTGGTGGCAAGAGCGCCAACGCATCGGCTGCGA
CCCCCGAAGGCGCTGCGGTACGTCTTCGTGTATTTCTTTTCGCCCTGCATGACTTGAATGGCTTATTTAATCGGGGGTTGTTTGCACTCTAGCGCTACCT
GAACGACTTCTACCTCCTCGCGAAGGCGGAGGGCTGGAAGTACTACTACTTCTCGGGCTTCGACACCCCGTACAAGGCGGAACAGATGCAGGAGCCAGAC
ACGGTCGAGGTCTATTTTGGTCTCTTTGGCACGGATGGCAAGATGAAGAGCGCGTACTCCGACCTCAAGATCGCCAAGATCGCGACCACGGAGAGCACTA
GCGGAAGCACCACCGGCACCTCAGGTACGGATTCGTCTTCTCCATCAGCGGGCACTGGTACCGATTCGACTACTGGCAAGGCCACCTCGGGTGGTATGTG
ACGACGCATCCATCGGTTGCACAAGTGCAATATGGGAAATTGGTTCCTAACATCCTATTTTGTGTTATTCCTGAATGAAATTTAGGCACGACTGATTCCA
CGTCCACTTCTCCTGGTTCAGTTCACGCCGGCGCCTCGAGCTCTGTTGGCACTGGCGCCGTCTCCAAGAGCAACTCGAGCTCGTCCTCGTCCGCGAAGAA
CGGCACCAGCGCGAACACGACGAGCGCTTCGTCGCCACTCGCGACCGCGGGCCTCACTGCCTGTGCCGCGATCATCTCTGCTGTCTTCATGAGCCTGTAA
ACGTGGTGACTGACCGTCGGTTGAAGAGCGTTGGCCAAGTTGTCTCGGTATACCGAGCTGATTTTTTCCCTTCATGTCCTCGCATGTTTTTTGAACGAGA
GAAAGGTTTCATAACCTACAATAAGACGCATCCTAGACTAAACCTAAAATAAGACGTGATGTGCACCCCTTTCCCCTATTAATATAGGAGATATATACTA
TATCTCGCATCGGATCTGTCCGACGTTTTGGATTGAAAAAGCCCACAAACGCAAAAAGCTGCTGCACTAACATGGAGGAGAACAATGGCGAGGTCGGGAC
GTCGCTGGCGGCGCGGATAAACAGCGCGGCGGGTCCGCAGCAGATCGATGTCGTGAACGAAGGTCTGCTCGTGCTCGTGATCGACACAAACCCGCTTTTC
TGGTTCGCCGATGGCCAGCAGCGCGGTCACAGCGGCAGCGACTTCCAGCAGCTCGTCGCGAGCACGCTCGTGTTTGTCAACTCGTATCTGCTGCTGCACC
GCAGCAACCGTATCGTGATCGTCGCTGCGCATGCGGGCAGAGCCGAGATGCTGTACCCGGATCCGGACCAGGAGGACACGTCGGGCAGCGCCGAGCAGTC
GGCCAAGGTGAACGCGAACGTGATGAAGAAGCTGCAGGCTCTCAGCGAGCTGCCGCTCGACCCGGCGAAGCCCAATGCGACTGCGATCGCAGCCTCTCTC
TCCAGATCTCTGTGCTGTAAGTGAATGTATATGAGTGTAAGCGCTAGAGTGGCGAGTAAGGTGCTGATATTGTTATGATGCTGTTTATTGAATAGTTATC
AACCGCGCCATCCGCGAGCAAAGCGATCTTCGTCCGCGCATCCTGGTGATCCAGAAGTCGCCCGACGTGTCGCAGCACTACATCTCGATCATGAACGGGA
TCTTCTCAGCGCAGAAGAAGAGCGTGGCGGTCGACGCGTGCATCCTCGCCAGCGAGCACTCGTCGTTCATGCAGCAGGCTGCGTACCTCACGGGTGGCAT
CTACTACAAGCCGCAGGACCACAGCGGACTACTCCAGTACTTGCTGTCGATCTACCTGCCGGACCCGAGCATGCGCAAGCTGCTGAAGCTACCAAGCCAG
GACTCGGTGGACTTCCGCGCGATGTGCTTTTGCCACAAGGAGGTGATCTCGACGGCGTTCGTGTGTCCCGTGTGCCTCTCGCTCTTCTGCGAGTTCCAGC
CGATCTGTTCGACCTGCGGCATCCGCAGCCGCATCCAGCCGGCCAAGAAGCTCCAGCAGAAGAAGCGTCTGCGTCCAACGTAGCAAGCTAGCTCTTCAGG
ATCGCACGCTCTCATGATAGATTGCTTTACGGTAGTTCGTTGATATCCGAATTTGGGTATTTACGGTTTGAGACAGGTGTCGCAAAGAACCAAGGCACAA
TTATTTTAGCCAATCATCGCAAAGAACCAAGGCACTATTATTTTGGGTTGGTAGGTACATTTGACTTGAGTGGAAATTGTAGTATATTTATAAAAGCTAC
AATCCCACAAGTCAAGTTAAATGTACCTGTCCCTTTTCTGATTGGCTGTAAAATATCGCCAACACTCACCAAAATACGAACTTTGGGCTCTCAGATTTAC
TAATTTGGGTTCCTAGAGAGCTGTGTTACAAAGCATCGTGATGCAAACAGAGGTGGCATTCCTGAACAAGCCGCGTCCTGAGCACATCGAACCCCAGCAA
GCAGCACCATGACCGGCAGCAGGTGAGGAAGCACGGCGTTCGTAGTGCGTTAATGTGTCACTCACTGTACGTGCATCTAACTGTCCTCTCGTCTAGAAAA
ACCATCGCGCAGACCTTCGAGGACGCCAAGGCGGCCAAGACCGCGGCCTTCATCACGTTCACCGCGTGCGGCTTCAAGACCAAGGCGGACACGGTCGAGA
TCCTCCTGGCGCTCCAGCGTGGCGGCGCTGACATCATCGAACTCGGCGTCCCGTACTCGGAC