Description :
From Genome Similarity Track
Location :
Scaffold_1271:3400- 7546
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1271-snap-gene-0.3Rap guanine nucleotide exchange factor (GEF) 4
Pytul_var.sporangiiferummaker-pug3_contig_1271-snap-gene-0.4Conserved gene of unknown function

Sequence
4146 bases(100 bases per row)
TGGACAAGATCTCGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGAGCAAAAACTGCCTGCAG
GTAGTGTGCTCTTCAAGCAGGGTGACAAGGCGCTTCAGGTGTTCTTTGTCGTGCGCGGTGAGCTCGTGATGACCAAGGAGATCGTGGACCCCGTGACGCA
CGTGACGCAGCTCGNNNNNNNNNNNNNNNNNCAGCCGGTACCGCGTCGTCGGCGATGATGCGTACGTTGGACAGTTTGATGTTAGGTTGCGTGTCCATTT
TCCCCCCAAGCATACTAACCAAAGTCGTTTGTGTCTATGCGCTTGAATTTAGAGCGGCTGGGACAACGTTCAACGAGAGCATCCTCCGCGAGGTAACGGT
CACGGCGACCACGCCCGTCGAGGTGCTCATTCTATCCAAGTACGACGTGTTCCATCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNACCTCGACCGGTTCCACAAAACGGAGAAATGGGAAAAATACAAGCACAAAGTGCTGCAAACGCACGTGAACCGCG
AGCGGCTCGCACGGATTCTGCCTCCTGCTGCGAAGAATGACGAGACGAGGCGAGAGCAGCATCGGAAAAAGCTTCAAGCGAGCACGAAACCTGTAGTTGA
GGCTCAAGGCCCATCTTTGAAGGACACTCTGAGCCAAAGTCAGGGTAGCAACGACGTCCCGGAGGAGGACATGCGGGAGCTCATGGCGCACAAGAATGTC
CTCGTGGACGCCAACGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CCACGTTCAATGCGGACGCGCCGCCGAGTGCTACGCGCAAGACACAGTTGGAAAGCGTGCTCGTGGCCGAGCGGCGGCACCAGGTGGCGGTCCTGAACGA
GGGCAATCCGCTGGCGTACTTTGACCTGGAGGCCATCAAGCAGCAGGAGAAGAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGGTCCGTCATCGATGGACGATTCACCGTTACTGCTGCCGTCATCATGTTCGTCGGCCTCGTCTGGCGCGTCGACAGCACTTGTCGACAAAGTTGCGAC
GAAGGTCATGAACCAGCTGGTGCAGGAAAACTTTATCTTTTCGCGACCCGAACGGATGGACGACAGCGAGGCTTTGCTGGCCGTACGCCACAGGAGGAGC
CTCACGAACCNNNNNNNNNNCGCGCGGGAGAGCCGTGAGCACGCGACGCACACTGCTCATCGGAAAAGAAGCAACGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGCAGACGATGGCGTTGATGCTGCGAGAGAAATC
GCGCTGCAGCGCTGCGAAGGCGACTTTGTGCTCCTGCGCGTGGCCACGGCTGGCGAAATTGNNNNNNNNNNGAGCAGCAGCATGTGCGCACGCTGCAGTC
GCCCACGCTACAGATCCTTGGCGCCGTTGAGTCGGTTGCTCAAGCTCGAGAGATCATGATTGCGACGCTCGTCAAGGAAGCGCGTCAACTCAAGTCCCCA
CATTCAGGACAAGATGAGGCGCAACTAGAAAGGACTGGAAGTCTAGAATTTGGGGCGTTTTACGTCCTGCACAAGAAGAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATTCGACGCGTTTGCGAAAGCGTCGAGTGTGAGCAGCAGCAGCGCTAGTAGTGCGC
ATGGCGGACGACGGCCGAGCATGTCAGTGGCTCATAGTGCGAGTTTAAATGGGCGCGGGGTCACGACGGCGCCTTGCCCAGTATCAGCGTCATCACCAGC
AGAGGTGTCGGGTCTGTTTGCATCGTTCCAGAAGCTCGCACTGAGCACTAGTGAGCAGAGCGAGATCGCTGCTGCTACTGCTCAGAGCTCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCCCACGCAGCACGATGGAGACCTCGTTGTCTCTCTTCCAGAGGTGCCTGAAGTCGGCGATCAGAGCAGCCCCGC
CAAGCCACGCGATTTCGACAATACCTCACAAGATGTACCCAGGTTTTTCGCCGTCGTGAGCATGATCCTGTCCAAGCACGAGATCGAAAACTCGGTGTGC
GATGAACCGTTTCTCTGCGTGCACGAGCTCTGCTCCTCGGAAGCCGAGGCCATGAACAGCGCACTCCACGTGATGTCACAGAGCTTCAACAACGCGGTGC
TGTGCGTGTTGCCCGGGAACGACGTGATCCACTTTGAAGACGCGTACAAGTTCTGCGTGCAGGTGGAGCCCGATCGCCGCGAGAAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTCACCGAATCGCCACAAGAGCAGCACGAGCGGGAAGGTGACGGCGTCAAATCCAGTGCGAGCTGTGAATGCTCGGAACGATC
CTGCTGGCGCCACTGCACTACCACCAGGNNNNNNNNNNNNNNNNCACGCCAACGTGGCAGACCGAGCGAGAAAAAGCGAGGCGCTTGCACCAGTTCATCT
GCTCGCGCTTGGGCCAAAAGGCGATCGCAGACAAAGAGCGTAAGGAGCAACAGCAGCAGGAGAGCGGCTTCACNNNNNNNNNNCAAGCCACTGCTCACGC
TCGAGGAGAAGCTCTCGACGCTGCACGAGTACCTCGAGAGCGCGAACGCGTCCGTGTCGAAAGGAGGCAACGCACTCGGCAAGTACCGCCAGATGAAGAA
GTTCGGCTCGATCATGAAGGCGCGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAACGGAGCTGCGGAGAGCGGTTCTTTGGCGAAAGGCACTGGCGCAGCGGCGAATCCATGACAGCAAAGGTGAGACCTACAAATTCCACA
CCAATTTCTGTATTATCATGACTGTGGATCTTACCAGGCAAAAACGACAAAACCTAGGCTGCAGTGTAGTGGTGGCTGCCCTTCTTGGCGTCCTCGACGG
AGAGCATGGGTGCGTGGAGTCCCGAGAGCGGCGTCTGCAGGTGTTGCTGCGTGAGCAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACGGGACGAGCGGTGCCGTGAAGTAGAGTTTGTCGTTCGTGTGCTGCGAGCACTTGACGTAGAACGCGATGGTGACCAGGCACGAGACCGC
GAGGAAGATGATGGAGAGCACGAGGCACACGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTGGTTCATGTGGCCCTCCTGATACAGAAACGCCGT
GACTCCCGTGAGCAGCACGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTTGGCGAGGAT
GAACGACATCATGACACCGAAGTTGACAATGTCCCAGAGCGTGACGAAGGGCACGACGGTGGCCACGACCGTGAAGAAGATGCCCGAAATGAGCGTGTTC
CAGAACAGGTTCTGGCGGCTGTCGACCTGGGCGAAGATCTNNNNNN