Description :
From Genome Similarity Track
Location :
Scaffold_320:340- 4542
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_320-snap-gene-0.10Conserved hypothetical protein
Pytve_DAOMBR484maker-pve_contig_320-snap-gene-0.17HECT ubiquitin ligase

Sequence
4202 bases(100 bases per row)
TCGCGCGCGACACGATGCGCCTCGGACCGACGCGTACGTTGCTGTTCCAGTACTCTTCCCCAGCTGTATCGCTGCATCCATAGCTGACTGTGTAATGTGG
TTGTCTTGACTTGAAACAGTGGACGTGGAGCACTCGCATGTGCGGTTCCTCGGCAACCTGGTGCTGAATCTATGGGACTGCGGCGGGTGGGTGGAGACAT
CGAGATGTTTCCTATACGTGAATGGGTACTTACACTGATACGCTCGTACTCGTCGCAGTCAGGATGCGTTCTATGAGAACTACTTTGAGAGCCAGCGCGA
CCACATCTTCCGCAGCGTCGAGCTGCTGATCTACGTGTTTGACATCGAGTCTCGCGAGATTGACGTACGTCCGAGGTGCTGTGCGATCTGGAATTGGAGA
GTGGCTGACGCGGTTATGTGTTGCCTTTCACGTTGGCAGAAAGATATGGCCCACTTTGACGGATGCATTGAGGCGATCGAGCAGAACTCGAGCAACGCCA
AGGTGTTCGTGCTGATCCACAAGATGGACCTCGTCCCGGAGGAACAGCGCGAGCGTGTGCGAATACTGTGCCGCTGTTTTACGTTCGTGTCAGTCACGAG
GAAAGCTCACATATGTGTTGTACAACTGTGCGCAGGTGTTCGCGAACAAGAAGGAGTCGATCGTGGCTCGCACCGGCGAGCTTCCGACCGTTTGCTTCGG
CACGTCGATCTGGGACGAGACGCTGTACCGCGCGTGGTCGTCGATCGTGTACTCGCTCATCCCGAATATGCAAGACCTGGAGAAGCACCTGAACAACTTT
TGCTCGATCTGCGACGCGGATGAGGTGGTGTTGTTCGAGCGCGCGACCTTCCTGGTCATCGCGCACGCGACCCATACCGAGCACCGCGATATCCACCGCT
TCGAGAAGATCAGCAACATCATCAAGCAGTTCAAGCTGAGCTGCAGCAAGTCGCAGGCTCAGTTCCAGGGCATGGAGGTGCGTAACTCGAACTTCACGGC
CTTCATCGACTTCTTCACGGCCAACACCTATATCATGGTCATCATGTCGGACGACACCATTCGTAAGTGCTGCTCTCTCTCTTACTCTGTTTGGACCATG
GACAACATCGTTTGAACAATATTGTTGCACTACCGGTGAACAGAACCCGCAACGATCCATCTCAACATCAAGGCGGCTCGCCCTGTGTTCGAACAGCACA
TTCAGCAAGCTGGCTAAGTATATGAAGCCAAAAGGTGGTACCTGGGATCACCGAGAGCGACAATCACATCGATGAGCGGGACGAGAACGTGCCGATGTGT
GTTGTCCGATTCGCTGGTAGCGACGGTTCTCAGACACGACAACAAGATGCAATCAATAGCATTTTTGGCAGCGAGCGTGAGCAACTGAAAATGATCTCAT
CCCTAGTATTTTCTTTTAGTCCTGGATTGTACTCGATAGCCGATCGTCAAGGAGTGGTTTACGCAGTTGTGAACCCTTGCACCTCGGCGTCGAGCAAGGC
GTACAATACGTGCTCCAAGTCGACTCGTTCCGCGTACAACGGCAGATCCAAGCGATTGAAGCACGCGTGACTGCGAATGTAGCCGCCGCTCACCCTCCAG
CTCACTCCCCTCAACGTGAAAGGACACGAGCGACCGTCATGGCTAGTCAGCGCGGCGAATCCGCCAACTGGGACACGAGAAGATCCCGTGGCGAACCGTA
GCAATCGACGGCGGTATTCGAGCGGCATCTCCTGCACCAGTTCCCAGAACCAGCGCATCGCCAAATGACCCTGCAGGTCCGCGTTGTACCTCGTGTTCCG
GCGCCAATCATCAACGTCGATGGCGTCGGACCCGCTCACCAAGTAGTCGAGTTCTTCTGGGTCGAACAGCATGAGCAAACTCCGCGGGATGACCTCGCAG
ATCCCCGATACGAATCGAGTCAGCGCGTGCTCCACCCGACCGAAGACAAGGTAGTGGAACTTGAGCATCACGAATTCGAGCTTGTTGGCGTCCGTCACGT
CCACACTTGCGCCGCCAGGAACGAGTTCGTACTCCACCATTCTCGAGTCAGCTCCACCTCTAGACTCGCTGACAGCGAACGTTAATGCCAACCCGTCAAC
GTCGTCGTGCTCGAGCAGCCAGTTCAGGCTTCGGAAGCTTTCTGGGTCAATATATTCGAGGTCGTCAAATGTGATGGGGACACCGAGGATGATCTTGAGC
AACGGTAGCGACAAATGAAAGCCAAGCGGGACTCCTTCCAGCAACGCGCGACCGACGAACCGACCTGCCGCCTGCGAATATGCGAGTTGCTGGTCCAAGC
TGCTGAAGCTGGCGTCGAGGTTGAAGGTCTGGTCTGGATCGTTGGCAGCGGCAAATACTCGGGTCTCGGATTCGCCAACAAGTCCTTCGGCCACCAGACA
AAACCACTCTCGCAGCAACCCTCCGGCGTCTACCCCGCTCTCGCCCTCGAAATGAATGCGCATGGACGAACGCACTTGCGACGCAGGTACTTGACTCAAC
AGTGTCAGCGACGCGTTGTATGCCTCTGAACGAGCGACATTCAGCTGAATGGGAGGATGAGCACTATCGGCTTCGCCGCGCAAGGACGTTGTCACCGTGG
CGAAATGAGCCAATTTGGTCGGAAAGTCTTGAGCTGCGAGTGCGCAGAACGCCTGTGGAGTCTCCATCCCAGCAGCATGTTCCACAGCCGCGAATGTGAC
TGGAGTTCCGTCGCGCACCTCGTTGATTCGCATCGGCCGACAAGCGACTGGAGCACTCGATCGGTTGTCGGAGAGTTGCAGACCGTTGGAGGAAGCTTCC
AAATCGGTGCGCACCACCACCACTTCTTCCAGTGGCGAAGCAGCATGTTGGGGATCAGTGGTCGACAAATTGCTCGATCCGAGGTTCAATGCTGACGAAA
GTGCAGAGCCATCGTCCACGACGTATCCTCGGTCGAGTAGGTGAGCGAGACTCGCAGACCTATCGGTCGATTCCTCGCTACAAACACGCGTGTGCCGCCA
GACGAGGCCTACCGCTTTGTCTCCGACCTGTCGAGTCCACTCACGACGCCGCCTGAGCAAAACGAAATGTTCATCTCCCAAACCTGTACGTCATCCTCGC
GCGGGAACATTGACAACACTTACATCACTCGTCGTTGGCGATGCGATAGTGGTGGAGGTGGAGAAATGCCGTGCTCCTGGGTCGTTTCGGCCGGCGCTCC
GAGTCGTCGCCACCACTCGCGCCGCCGACTTGGCCGCTCGACCGGCATCGCCGTCCCGCACAGGACGCAAAAGTCGCTGTGCGACAGGTTGGCGAATGCG
CACAGCGGACATGCGCGAGATGGAGTTTGAGCATCGAGTTGTAATCTGCACGGCAGACAACATTGGTCGCTGAGTGAGCCCGGAATACCCAGTCTGTTCG
CTTTCACCTACCGAGCCACCTGCGCTGTGCTGCTAAAGAACGCAAATGAAAGCACACATCAGCGTTGTTGACGAGACGCTTTCTAGGTCGAGAGCTGCAG
TTCACGCACCTGTCGAGCAGCGGCGCGTTCAGGGCGATCTGTGCCTTGTAGCGTCCGACGGCGCGCCTGAAGCAGACGGCGCCGACCACGAAGATGCCCA
CCAGCAGCCCGATGAGTACGGGAGCTAGCGCCTGCATGCTTCTGCGCGAGGGTCAGCGGCTGGAAATCACGGAATGGCAGCGAACGTCAAGGTACAACGT
GGAACATCCGCCGAGAGAGGTCTCCTGGCGGAACGCGCTATGCGGTACCGAACGAGCAGGATTGGCGCCTGGGGCAAGATTGTGGTGTCTGCAATCACAT
TTAGCAGTGCAATTCATATAGACAGCGTTGCTCAAACAGATCAATAGCCATTCGCGAGAATCCATTACATATCGACAACACGCAGAGTATAATAATCCCG
AGGTGGCGTACTGCGCTTTTCTAGGTGTTGGCTACATGTTGTCGGTACCGCATGTCTCTTATCTGCTGTTCGAGGCGGTGCCACGCAGCAACATTTCTTC
CAGATTCATGAGCCCCTGTCGGTGTCCTCGATGCAACAAGTCCGCTGTACTGCTCACCAACTCGGACACGGCACACACCCTGTGAGCTTGGAGCGAAGCA
GCGCTCAACCAGGCACGAAGCTCATTGCACACACCTGAGTAACATGCATCAAAGACATGCATTCAAAGATAGTCGATCTCCTACGCTCGCAACACTACCT
CT