Description :
From Genome Similarity Track
Location :
Scaffold_287:340- 4448
Transcript NameFunction/comments
Phypl_g6466HECT E3 ubiquitin ligase, putative
Phypl_g6467hypothetical protein
Phypl_g6468enoyl-CoA hydratase/isomerase family, putative

Sequence
4108 bases(100 bases per row)
aacagcgccaagcgCAAGACCTGCCTCATGTGCGGCACCAGCATCGGGTTCCTCGTGGGCGGCGGGCTCGGGCGTCGGAAGAGCTcgcggatgctgctgc
gcaacaacAGTCGCGGCATCGCTGGCGCTGATTTGGCCGGCGGGGCCGGAGAAGAGGAGGACATCGAGGCGCTGAGGGCTCGACAGCGCGCGCTATTCAA
GCGCCGCATGAACACGATGGCGGCCAGGAAGAACCTgtcgcagcgccagcgggGAGCGTTCCGACGCCGCCTGTGGCAGCGCAAACAGTTGACGGACGGC
AAGTTCCACTGGGTCCGACAGAACAGCACCGACGTGGTGGACCCAGTGCCCGAGGTGCAGActggagatgcagcgcagccGGCACTGCCTTCGACGGCGG
AGGCGACATCTCTTGCAGGGCCGAATGGAGAGAGTGTCACGGATTACCACAACCTGCGCTCGCAGGGCTTCGTGTCGATGTATGACGCTTCCGGCAGGTT
GACATGGACCAAGGCCGACGAAGTGTCCATTGACATGGAGTCGTTTGACAAGATGCGCAACGGGTTGGAGAAAATGGACTTTGAGGTGTGGCCGAGTGCG
GTGAATGGTTGTTGCACATTGAGGTACTGCCTCCTCACTTGCTTTTGTGTTCTGTAGGGTGTGATGGCTCTTGGGTTCCGCATGAAGAAGCAGTGGTTCT
TGGTGCAATTATCCCGCATTGCGACTCCCGTGACCGAAGCCGTTGCCAAGCTGAGTACGTTTTTCAACGACCCGCTCAAGCTGATCAGTGTTGTTTGCCG
AGATTTGAAGCTGACTTTTGTGATTGATTGTCTTGATACGTAGCGGTGACAAGGGATCAGATCATCGAGcaatcgctgcagctcgctgaagctgcaccCG
ATGCGCTTCACGCGTATCTGAAGATTACCTTCGAGGGTGAACCGGGTATTGATGCGGGAggcctgctgcgcgagtgGTTTGGGATCGTCTGCAAGCAGAT
CTTCAGTGAGAAGATGGGACTCTTTGTCCCGACGAAGGGCGAGGACATGAGCTACTGGATCGACCCGATTTCTggcgagaagaacgaggacCACTTAAAG
CTGTTCCGTCTAGCTGGTATCTTGATTGGCAAAGCGCTTTTTGAGGGTATCGTGCTGGATGTGCACTTGGCTCTGCCTTTGCTAAAGCACGTGCTGGGCA
TTCCAATTTCGTTCTCCGACCTTGAATTcttggacgaagagctgcaccGGAACTGCAAGTGGCTTCGTAGCAACAATCACGTGGAAGCCCTTTGCCTGAC
GTTCAGCGTGATGCTTGAAAACGGCACCGAGGTGGATCTCAAGGAAAACGGGCGCAACATTGACGTGACAGACGAAAACAAGGAGGAGTACCTTCGGCTT
ATCCTGGAGCACCGTATGCTCGATAGCATTACtgaccagctgcaggaaTTCCTCATGGGTATCTATGATGTAGTGCCTAAGGCACTGCTCTCCGTGTTCG
ACtaccaggagctggagcttaTTCTGTGCGGTATCCCCACTATCGATACTGCGGATTGGCGAGCAAACACCCACGTGCGCTACATCAAGCCTGATCAAaa
caagaagggcaagatTACCGAAAACGAGCAGAATGGAGTACTGGAATGGTTTTGGATTGTTGTCGAAGGACTTGCGCCGGAAGAGCGtgcgaagctgctt
caatTTGTCACTAGTACCAGTCGTGTCCCCGTGGAGGGTTTCCGCGGGCTTatgagctccagcggaaTTATCCACCAATTCACGATCCAGCTTGTGCCAC
GAGGCAAGGAGAAATCGGACTTGTTCCCCAAGGCGCACACCTGCTTCAACCGACTCGACTTGCCCATATACCGCGAcatgatggagctggaaaCGTACTT
GACGATGGTGTCTCAAATGGAGGTCTTCGGCTTTGGCCTCGAATAAGTTGGATGCCACACAAGAAGCATTCTCCAGCTCAGTATATATAACGACACCTCG
CGATGAGAAGCGACTTGTACAGCACTCAAGCATGTCAAGTTGCCGCACGGCAAAACCCTCCCGTGTACGTAGTTCCATTACTTTGtctgctccttctgct
tggcaATATGCGCCGCAACatccttctgcagcatctcctggTGACGTTTATCTCTGCGTCCTTGGCTGCCGTCCAACGACGAACTGAGCCAAGTAGGCGa
ggccttcttcttctcgccaGGCTGCTCCTTGGACTGGAGCACAGCTAGCGCTGCTTCGATCTTGCTCTCACTTGCAGCTGGTAACACCTTGGACACCTGT
GTCTTCTCTTTTTCAGCCTTACTGCCGGCAGCACTGGCCACCTTGGTAGCGTTCTCTCGACTGGCgacggcctcctcctccagccgTTGGAGACGGTCGC
GCATCTCCTGGATCACAGTAGCCAGCGCCCATTCCTTGTCCTCTCGCTCCTTGACAATGCTCAGCTCGCCTTCCACCTGCTCCAGACGCAAGGCCTCGTT
TTCCAGTTCCATGCGTCGCTTCACTGAGTACAGGTACAGCCCCAACACCGTGCCAGGTCCAAAGGCGAACAGTCCGTACAGAAGCTTGCGCTTCGGAgac
agcagcttcctgcATCGCGAAGAGAGGTACCAGACATAGCAGAACACTGATCAGATAGAGCACTATCTATTGCAACGCACTAGATGTGTTGCACGCACTC
GAACGCGTCCGGAGGCGCGTCCGAGAAGAGCATCTTGACTCTGCCGGCCGCCATGATTGTTTCGAGGCGAATCGCCAAATGAGTGCTAAGTGCGCTTTAA
GTTCGCAGTCAGACGTCGTGTACTTCAGTCCTAATGCACTTCAACTGCCCCAAGCAGCACGATAACCGATGCGAAGCACAGCTGGCTACGGCATCCTACT
GACACGGCCCTGCGTTCTCTATTTATTTTGtatttttttgtttttttaTCCTCCCACTTGACGGCAAGTGCTGCCAATATGGGAAATGCGACGAGCCTCC
GCTGCCTTCCTCCATCGTGTTTCTCTCCCTATCTTCTCTGTCTCAATCGCCTGTGGTGCTGGCTGCTTGAGTCCACACGGCGCTGCTTGTTTGACGTCGG
ATTCTGAACAGCACTGACACACCAATCCAGTGgtgtcgtcctccttgctgcTTCGCCCGCCACCAGTCGTAGGGAGCTCCCGTGCGTGCACGCGATTGAT
TTGTGGCTGCATACACTTAGTGCTTCTTGTACAAAAACTCATTGGACACCCACGGCGCGCCAGAGCTGCCCGCGTTGaccacgtccagcgtcttgttgCG
GATCTCATCGGCCTTGGCGCGGCTCACGCCTCGCAGCCAGATCTCATAGCGGTAGTTGTTGCCCGagtccttcttgtccttcttgttgttCTGTTGGTCC
GAGCGCCACAAGCAATCGAGTCAGACATTGCACATCACGACGCCACCCTACTAGGTTCGCCAACGCGTACCTTGTGGATGACTCGAACGCCCGTCACCTC
GTTGCCCGGATCAATGAGCTCTCCGATGGCCCCTAGCACTAGCTTCTCCcagaactcgtccagctcctgaGCTCCCACCTCTGCCAGTTGCAAACCCCAT
CAACAACGACCACTTCGCCAAGCGTGCCCTTCAGACGACACACACTAGAAAGCACATCGCGTACCTTTCCGGATGGACCACTCACCGCCGTTCTTGTTCT
CCGGGTCCTCCCACTCGGGCACGATGCCCTCCTTGAAGACAGCGAAGCCCTCCACCGTTCGGTCCGCGAACTTCTTGCGGGTGAAGCCGTCGAACAGCAC
CTGGCTGCTCGGAGCGGACGCAACCCCCGCGCGCACGCAACACACACAGCACAAATACAGAGCACACGTTAGCACAGCAGTGTAAACGTCAGCAGTGACG
CCCGCGATTTGCTGTCAACGACTGGCTGGCTGCCCCACCTCGGCGACGGGATGTTGTTCCAGTAGCCCCAGAACTCCTCGAcggtgctgaaggagcagag
CTTGAAGAGCTTGTCGCCGTACGACATGTTCTTCccctgctcgcgctgctcccAGATGGCCCAGggctcgttgagctcgtgcttctcgGCATCCCCAGAC
GCCATCGT