Description :
From Genome Similarity Track
Location :
Scaffold_3628:340- 1530
Transcript NameFunction/comments
Phyta_totarag15396hypothetical protein

Sequence
1190 bases(100 bases per row)
GTCAAAAACTCCACCGAAAggcgtcgaggcgacgaaggcgatCAGCGCCGGGAATTGACGCTGCGAGCAGTGCAGACGGTTGCAAACGTCCAGGACAAGA
ACAGCTTACAAGCTCACGTGCAGCagggctgcacgaagaaTCGAATGCGCATCGAGCCGGGCTTGATGACGCGCGGCCGCGGATACAATCCGCCGGCGAC
AACAACACGAACCCATCCAGTGCCCGGCCAAGCgggcgaggacgaagaacACGCGGATCCGGGCGCCaaaagaggaagaaacgaCAGTGAAAGCAGAAAG
AGCTGCGCGAGGCTCGGTCCGGGACCGAGACGGTAAACAAGATGCCTGTCGGGTAGACATCTAATCCGACGTCAAGCGTCGAGACATTGAATGTCCTGGC
ACAGACCGGTACTGGTCTTCAGTACAGGAACGTGGCACTTTAGAACCTGCGTCGGAGTTGACATCGCTTCCAGTGtcatgagctggaagcgcttggcTCA
TGACTTGCACGATGGACGCATCGAGCAGATTTGCCTCCTTTTGGACAATGAaaggttgaagtgcgagGCGGAAGCGTTGAAGCAGCGCTTCGTTGGCAGT
ACTACTGAGTGTGAGGGCACTCTCGgcgccaagacgaagaagcagcgcttcaagGAGCAGAGTTGGGACTCGCTCAAGGCGAGTCCCTATTACGAGATTC
TGCGAGAGTACAGGGACGTACTCCCGGACGGCATCCCTGCGGAGCTCTCGCAGGATAAGGGAATTCAGCACGAGATACTGTGTCACGCGGtagtggccac
tgccgcgagAGCAAGTGAAGGCGATCGACGACTACTTTGAGGGTCGTAGCTCActttgacgacgtgttcatTCACAGCCGGGTCGTGTGACAGAAAGACG
GGTGTTGAGATGCACAAGGTGCATCTCCGTAAGCTGTTTGGGCTGATGCGCAAGCACAAGCTCTATGCgaacctgaagaagtgcatCTTCGGGGCGAGCG
AGATACCCGTGCTTGAGTGTCTCGTCGGGAAGAACGGCGTACGCCCTGACCCAGAGGAGGTCAGAGTGATCAATGAATGGCCGGAGCCATCCAACGTCAA
GGAACTGAGGCAGTTCCTTGGACTTGCCACGTACTTGTGCAAGTACGTGGAGAACTACGCGGGCAAGATTCGCCCGCTGTCACAGCTTCT