Description :
From Genome Similarity Track
Location :
Scaffold_1552:34- 7894
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1552-snap-gene-0.4Structural maintenance of chromosomes protein 5
Pytar_ATCC12531maker-par_contig_1552-snap-gene-0.3Metal-dependent hydrolase (Beta-lactamase superfamily)
Pytar_ATCC12531maker-par_contig_1552-fgenesh-gene-0.2SET domain containing 3, partial

Sequence
7860 bases(100 bases per row)
ATACACCGCCCGATTGTTCTTCGGCCGTCATAGTCGTCAGCTTGGTATTCTTGCGGAACTGCGCGCGACGTTCAATCCCCCACTTGGAGATATCCTAAAG
AGAACGACTTGTCACTATACATACAGGGTTTGGGAGGGATTTCGTGCCGCACTTACCGGGTCCGTGTCGTCCAGCACGATCTCGCCGACGCATCCAATGT
CACGGAAAAATTCCTTGAACGACGAATCAATCTTGCCCACAACTTCGCGCAGCTTGGCATACCACGCGTCCTTAATGCCGTTGACTTGGTCTTCGCCGTT
CTGGACGAAGCCTTCAAGCGCTTGCAGCTCGATCTCTTCCTGCTCAATCTCGCCGCAAATGCGCTGGTAGATCTCGCGCACACTGCGGTCGCCACGGAAG
CAGTCAAGCGATGCCTTGTTGTTCTCAATACACCCACGCAGCTCGTCCAAATCATCCGAGAGCTTGGCAAATTGCTCTTGGTACTCGTCCCAAGGCGCTT
CGTGCTCGGCTTTCTTCTTCACCTTCATGGCCTTCTTTGCGAGCTCCATGAGGTTGTCCTTGGCACGCTTGAAGGCTTCTTGCAAGTCGCGAATCGCGGC
TTCGGCGCGACGCAAATGCTTATCAATAAACTCAACGCGCACTTGCTGCGAACCCACTTTCAGAGCAAGCGTCGCATCTTGAGCCGTCACCACCAGGAGT
TTTTTCGTGAGCGTGAGGCACTCGTGGAGGTGCTTGGCCTGCTTGGCCGCTTGGCCCTTGAGCTTGCGCACCATAGCGTTTTCCCTGTCCGACAAATCCT
TGGCGAGCTCGCTGCGCAGACTATAAGCCTTGTTCTCACCCTCACTGATCTTCTCGTCGAGGCGCACCATCGTTTTAAGCTGCGAGCGGATCTCCTGGAT
GCGTTGTGACGACTGGGTCCGTGACTCCGAGAACTGGCGCTCTTCCGCCTTGAGGTCGGTGATTTCTTGCTCGACACTTCTCGCCTCAGCCGAAAGCTCT
TCGAGCATTCGCTTGAGCTCGTTCTTCTCGTCGTCATTCGACGAAGATGCCGCCAACAGAGAGGCGTTTTTCAAGTCATTGGTGCGCGTGGTCACATTGC
GATCGCCGTACTTGGAGACTGACGATACGTACTTCTTGTACGGCGTGACAAACGCGGCCGATTTGCGATCCCCCGTGGTCAGTGCCGCGAAGATATTGAC
GCCGCGGTTAATCACCTCTTCGGTGTGATTGGAGCCGACCAGCACCGAGTGGAAACCTCCCTGATTGCGCAGCACTTCGTGGATAATATCAGGAGCAATC
ACGAGCTCGTCGAGATAGCCCGTGATGCCGTAATCCTCTCGAAACCCGTCGAGTTGCTGGGCCGTGTAGGGACGGTTGAACGGCTTGCACTGTCCGCCTT
CAACCGTGATGATCGAGATCTTGATGCGCTGCGAGCCCGGGTTCTTTTCATTGTTGAGTTCCTCGATCAGTGTGTCGTAGTCGGCTTTGCACTCGACAAC
AAGCGCTCCCATGACCCACTTGGGCAGCGTGTCCTCGACGTACTTCGCGTGAAGCGCCTCATTCACTTTCATCTCAAGCGCAACGGGACCCCACACTTTG
CGCTGCAGTTTGTCGCGATTCTTCTTGACCCATTCGGCGGCGCGGACAGCATCCGGATCACTCCTGTGAAGAGCAGCACGGCGCTGCTCGTCTTCGTCGT
CCAGTCGCCCCAGTTTCTGCTGGCCTCGTCGGACATCTTGATCAATTGCTGCGAGCTGTGGAAGGAGGAGAGCGAATGAGCGACGCGTCGAGCAGATCTG
AATATTCATTAAGGAGTGCAGAGTCATACCTTGCGACTGGCAGCTTCTCGTTTGCTAGCGATTTCCGCGTGCTGCAAAAGAAAAGCCATCCTCAGTGAGA
AAACAACATACAACAAAGCAGCCAATTTACAAGACGCACCTCGAGCTCTTTCTCACGCTGCTCCTTTTCGAGCTTCACTTTCATCTTCTTGAGCTGCGCC
TCATCGGTCATGGCCTCACGCTCGGCTTTCCACTTGCCGAGATCGTCTTCGATCCGTTCCAGCTTGCGCCGCGCTAGGTTGTGCTGATTCTTCAGCTCGG
TCACTTCCGACACCGTCTTGCTCTGCGCGTTCTCCAGCGACTCCACCTGCACACACGACAACAAAGTAAGCTTTGCGAAGTTCACACGACACTAAAACTG
TAAACGAACATGCTGCTTTTCTCGCTTGAGCTTTTCTTCGATGGCTCGCTTGGCATTTTCTGCGTCTCCCCTCCTGCTCACAAAAAGCAGCCCACAATGA
ACGATCTGTGCTGGTTGACAAGTCACCAGGGACGTGCCGAACGTACTCGGCTTTGAACTTATCCAGTTTGAGCGACTCCTTGTCAAACAATTCTTGCAAC
GGCGTCACTTGCTTTTCCTTGGCGAGCTGTTGATATGATGAGTGTGAACCTTAAGCTCTCTCTCTTTCTCTCAATTACTCAGAAATGGACACCGATGCAC
GTACCTCCATCTCCTCCTTGCAGCGCTTCTTCTCGGTTTTAAGCTCCTCGACTTCGCGCTTGATTTCTTCGAACTCGAGCCACAGGCATTTCTTCTCCAT
CAGCTCCGTCTACCATAAACGATCCACACCGATGCGTGAGCCTTCATTGATCAACACCATGGACCACGGCAACCGCCTCACCTCTTCGATCCGCGACTCG
TGCTCCATGATGCGCTCGACTTCTTTTTCTCGTTGGCGATTCTCATTCTTCTTGAGCTCGAGCGACGCACGCGCCGACTCCAATTGCTAAAATAGTCATA
ACATCCATCCACCATTAGTGAGGCGCACCAGACGCACCACCGATTGCTTCAGTCCGTACATGTTCCTTGTCGTGCATGTCGCGCTGGAGTTCAATGATGT
GGTCGTGGGTCACGGCCAGCTCGCCATCAAGCACGGCCGTCTCGGTCGCCTTGAGCAGCTGCACAGCGTTCATCCGCGAGAACTCGCCCACTTTGTCCTG
CGGCAAGAACTGGCACAAGTTGTCGATTTGGATCTTGGCCGACTCCATGAGCGCCGTCACGTTCTTCAGCGTCGACTCGCGGCCGTCCAAGTACCACAGG
CTCTTGTTGTCGCGGAAGATCTGGCGCCGGATCACGCGGTTGCCGCGCTCGAAAAACAGCTCAATCTGGCGTATACGATTTTGTGAGTTCGACGCCTGAC
GGTTCGAAGACTGTGGGCTCGTAGACTCACCTCCGTGTATCCATTCTCCTTCTCGTGGCGCACAAACTGCCCGACTTTGTCCGCGCGTCCAAGTAACTAC
GACAGGCACGGCACGAACAGTTACCTATCTGCGGGACCCACGGAACCTTCTCCGACCATCGCACCTTGGTGCTGCCCGCGAGCCCGACGCAGAGCGCGCA
GACGATCGACGACTTGCCCGTGCCGTTGGGCCCGAGAATGAGGTTTAGCCGCGGGCCGGGGAAGAACTCGGTGTCCGTGTACGTGAGAAAGTTGTGGAGC
TTGACGCGGAAGATGGAGCCGTCGACAAACTCGTCGCAGGACGCCGCCGTCGTGTCCACGTNNNNNNNNNNGGTTACCTATTTGCGGGGCCCACGGAACC
TTCTCCTACCATCGCACCTTGGTGCTGCCNNNNNNNNNNNNNNNNCCCACCACCGTCATGGAGCCGATCGTCACCAAGTCTCTCGCCGTTGGTCGCGCGG
CTTGCTTTGATGGAGAACGTTTCCCGCGAAAAAAACTCCGAAAGGCGGGATTTCCAGGTTGAATAGTCTGAAGTAATGTGGCACACACTATTTGGGGGTA
AAAGGTGTACACCACACTATCTTCGGTATCTTTGGTCGTCAACGCCACTGAAATGCCAGCCAGCAGCATGATGGCGCGGCGGCGACGGCCGGCGACGCTG
CGCCGTTGCGCGCGGCTCATCCACGGCGACACTGTGGAAGCGGCGCAAGCAGCCGATGTATCAACTCAAGCTCCAGCGCCCACGCCGCGCTGGCAAACGT
TGGAGTGCATCAAGCAAAAGCCGCCCGGATCGTTGATGCGTCAGGTCATTTCGAGTCGACAGCTCCAGCTCGGCAGCGTGCCGTCGCGGTCCTGCAACAA
CAAGACCATCAAGCACAACCATAGCAGCGACCCCAATGCTCGCTGCGAGTTGCCATTCACTGGCTTTGAGCTGTTGTTTCTGGGCACGAGCGCCGGCTCG
CCGTCCGTGCGGCGCAACCCGACCGCCGTCTGCCTGCGAACGGACAAGAGCAACTGGATGTTTGACTGCGCCGAGGCATCATTGCGGCAGCTCATGATGT
CGACGATTCGTGTGCCGTCGACGGATAAGTTTTTCGTGACCCACTTGCACGGCGACCATCTCTATGGGCTGCCGGGCATTCTGTGCACTCTCGACACCCA
CCACGACTCGTACATTGGCCCGCTAACGCAGAAGCCAGCGCCATACCCCATCTCCGTGTATGGGCCGTTGGGCGTGTTTGCGTACCTCAACACGGCATTC
ATGACAAGCAGCACGCGCCTCACGAATCTCGTCGTCACCGTCCACGAGCTCGTGACGCCCGAGATGGTCGAGAATGCGACTCCATTCGAAAAGTACGCCC
GCGAGGCGCCCACACATCCGGTACGCCTTGATGCTTTGCCTGCCGGGTGGACGGTCAGCTATTTTAACGTGGGGTGTTATCATGGCAGTCAATGCGCCGA
GAATATATCTATGGTGAGTCGAACGGCAATGATCTCGTGTGGAACGTGTTTGAAGACGCTTCACACAAGGTCACAGCGTCGACGCTCAAGCATACCGTCC
TCAGCTTTGGGTATGCACCTCCCGTATCCACGTGTGCTTGTATGCCGGACTGCTGACCTATTCGTCTTTTTCAGATACGTCGTCGAGGAGCACGCACAGC
CAGGCAAACTGCGAGCCGACTTGCTCAAAGCTCGAGGGTTACGACCCGGGCCGGCGTATCGTCTACTAAAGGAAGGCCAAACCGTGACGTTACCCAATGG
CGACGTCATTCTCCCGAGCGAAGTCATGGGGCCATCGACTCGAGGCCGCAAGGCCGTGATTCTGGGCGACACGGCCGACTCTTCGTGTCTCTTTGACATT
GGACGTAATTGCGATGTACTGGTCCACGAAGCCACACTGTCCCACGACATGGTTCAGCGCGCTGTCGAGCGAGGCCACTCGACGGCGCGTATGGCCGGGT
ACACGGCGCGCCGTCTGAACGCGACGCTGCTCGCGCTGACCCATTTCAGCCACCGCTTTCGTGAATGGGCACCCCACGCTGTTGGGACCACGCAGCATCT
CGCGCTGGATGCGCAAGTCACGTTTGGTCGCAAGGCCGTCGTGGCCGCAACGGATTTCTTGCGAATCCCCATTGCTCGCGCGCCGAGCCATGAATAGAAA
GAATAGAGTGAATTACCATCCACGTCGTCCTGCTCTAGTCTTCCTCTACCCTAGCTCCTGGTTAAGCGTCAAACACGACCGTGTTCTGCTTTGCCAAGGC
GACCGCGCTCCGCTGAGACTCAAAATATCGCCGAAACAATGAGCCATGAGAGGCTCCGGCGACTTTCGAGATGAACGCCAGCAACTGACGGTCTGCGTCT
TCACATGCGATTGCGAACCACTGCTTGGCGAGCTCCCGTTCCTCGCTCGTCCACTCAAAGACCTTGTCCGCCCCAAGCGTGGCCGACGACCTCAGTGCCT
TGGTTAAGCTCTCCTTGGACAAGTTCAAAATCTGCAGCACCCGTAAAGTAGCATACGACACCAGTGAGCCATCGGTTCCGACTTGGATTTGCACGCTCTC
GTCTCCAAGTGCCACACTGCTGTCTTTTGCGAGCTCCTTTTGAATGATCAGACGGCGGATCTTGAGCAGAGGATCCGATGCATTCAAGGCAAGCTGGATA
GTGGTTCGATCCCACGCGTTCGCATCGTCGACAAAGCCGGAGTACATGAGGAGTTCCTCGTTCGTGCGCGGCCCGTAAAACATCGCGACTTCTTCATCCA
CAGCGAACGCGCGCTTCGCGTGGCACACAACGACACGCTTTGCTGGATCCGAAAACGTTCCGATGCGCTCGCCGGCTTCGTGGTTGCACATGTCCCAGCC
TGGAATCAGTGCCAACGCGCCCCGACCGGCCTCGCCGACCACCACCTCATTCTGCCGGGTGAGCACGACGCCCATGGCCCAAAAGTAATTGGAGAGCGTC
AATGCCGCCGCAGGAATCGGGCACTGCGGCCAGCCTTGCTGACACAGGCGCTGCAGGTAAAAGAACTGCTTGATCGAGTTGTACAGCAGCTTCACGGCGG
GCTCGAACAGGGGTGTTCCGTCGATGGCTTCAAAGTCCGAGACACTGTAAAAGAGCGGGATGTCAAAACTGGCGGGCAACATTGCTATGTACGGCGCGAA
AAACGAAGGGCGTGTCTTTGCCGTCTTGCACGCCTCGTTGAGCACTCGCAGCGCAAGCACGCAACTCGGGAACCGGGACAGCAGCGGATCCTGCGCGACG
TGGTTCCATGGCCCATTGCTCTTTTCAACGGGGCCGAGAGAAGGGTCTGCGCCCAGGATGATACCATACGGAATGGAGATGAATGTATCTCCCTGTTGCA
GAGCATCTTGTGCGATGAGTCCATTGCCGTGGTCGCCCGCTCGCTGGACCTTCACCATGGCGGCGTCAGCGTGAACTGAGAGCCACTGGTTGAACGACGC
CAAGTCGGCTTCTGAAGGCGCGTCGCGGCGAACGAGTTGCTGTGCATCTCGCTCACGTAGCTTTTCAATCTCCTTTAGCGCTCGTGTCGCGTAGCGCAGC
ACGTCGTTGGTCCAGCACGACGCGCCCGCAGTGAGCTCTTGGAGGTCTTGCATCATCTTCCGGCGGATCGAGAACTGAAACAGGTGAAAATGGGGATAAC
CTCCTATATTTAATACTGTGAAATTTGATAAAGATAAATGTTTGGAATGCCTTTGTTAAAATCACCGATAATCGCACAACAGAATTGATGACACCAACAA
TGATATCGATCGATCGCTTCGCTCATCAAATCCAACTTTCGACATTCACATGCATGGCAGCGCCTACGTCCCTACAGCCGCTTCTACGAATCGACACTAC
AACTCCGTCACGTCTTCAACTCGCCCAGCAGCGCCGTCACGTCTTCTACGGTGAGCTCGCGATCGGGCTTACGCAAAATGTTCTGGACGCTCTCGGACGC
GCCGCTGTGGGACAACGAGACGCTCTTGTCCACAAACCCTGGCAGGCGATCCTGGTTCACGTCAACCCAACGGAGGTAGTTCAAAGACTGCTCCGGTGTG
AGGATCGAGTGGATGACATCGGTTTGCTGCTGCACTTCCTTTGCTCGGTCTTCCAAGCTGTCCTTGAGTTTGCTCAAGTACGTCTACAGGAAGCGATATA
CGAACGTGAGATTGGATATGATAATATAGGAGTCGGCATAAGCCATGGCCAGCAGAATTACGCACCACGGCAAGCGCCACCCGTCGCCGCTCAGACTTGC
TGGACTTAGTGTCTCCCGATCTACACAGAGACGGATACCGCGACGTGAGATATAATATCCAACCGATCAAACAGAATGGAGTACCCGTACTTATAGAGAG
ACTTGAGCTTCTCATCCTGCTCGTACGTCAACGCCAGGTCCGCAATCAGCGTTTGCCAGAGCGAGTCCTTCTTCACAATCGATGGCAGCTTGCGCTTCTC
GCCATTGTCGACTCCGCCTTTGGGGCCGAGGCCATTGCCTTCATCATAAAACACATCGTCCTGGATACTCAGCCACAGCAGGAAGCGGCAGTACGGCGGC
AACAGCAAGTTGTCGAGCTGGCGGAAGTTGTAGTCCTTGACAGCGTTGCGTTCCTATATC