Description :
From Genome Similarity Track
Location :
Scaffold_1989:34- 2606
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1989-snap-gene-0.1Polyprotein
Pytir_DAOMBR486maker-pir_contig_1989-snap-gene-0.2Polyprotein

Sequence
2572 bases(100 bases per row)
CTCGCCCCGTGACACCTGATAGCACTTAGTAGTCCGTCCAACGCCATGAGCGGCGCGCCGATCGAAGGAGTCGACGGCTTGGCGCTGAACCACCAGGACT
TCCCCCACCTCACCCCGTTCGAGTGGGAAGAGCTGCGACGCCTCGCAGACGCGTCCAGCATCACCGTGGTCGCGGCGGTGCTTACCGCGACGCCNNNNNN
NNNNAGACGCATCCGACATCACCGTGGTCGCGGCGGCGCTTACCGCGGCGCCTGCGCAGCAGCAGCGAACGGCAATCCAAGAGTTCATGACGCGCGAACT
CACCGACTTACGTCGGCAGGCTTCAACTCCCGTGCAGTCAAAGAACTACATCGTGAAGCTCGACGTGTCGAGCTACAGCGGCGAAGGCCCTCACCGGTTG
GCGCTCAACCGGTGGCTCTGCGAGGTGGACATCGCCATCCACGCCCGACAGCTCGCGCGCACCCACTACCTGCTGTCGAAGCTCTCCGGCAAAGCGAANN
NNNNNNNNAACAGCTCACGAGTGAGCTCGCGCGTACCCACTACATGCTGTCGAAGCTCTCCGGCAAAGCGAANNNNNNNNNNACGGCCGACAGCTCACGA
GCGAGCTCGCGCGCATCCACTGCCTGCTGTCGAAGCTCTCAGGCAAAACGAAGGAGTGGGCGCTCGGCAAGCTCGTCGCGGATCCCGGGTGCTTCCCGAG
GTTGGACTCGCTTAAGGACGACCTGCGGCTGGCTTTCGAGCCGCCGCAGGATGAGAGCCAACACCGGACGGCNNNNNNNNNNTCCTCACGCTGCGCCAAG
GTCGCTCGTCGATGATCGACTACATCCAGCGCGCCCGACACCTCNNNNNNNNNNCCAACATCGGGCGGCGTTTCTCGTGCTGCGCCAAGGTCGTTCGCCG
ATGGTCGACTACATCCAACGCGCTCGACACCTCGCGTCGTGCGTGGTCGAGAACCCGATCGACATGGTCACGCAAGTCCACATCTTCGTCGCCGGCGGCC
GGCACTCATGCCGACGACGCTCAAAGAAGCGTTTGCGATCGCGCTTCGAGANNNNNNNNNNGCGCCAAGGTCGCTCGCCGATGGTCGACTACATCCAGCG
CGCCCGACATCTCGCGTCGTGCGTGGTCAAGAACCCGATCGACATGGTCACGCAAGTCCACGTCTTCGTCGCCGGCATGAGTGCCGGCCACCAGCAGTTC
TACCTCACCCGCAAGCCGCCGGCGACGCTCGAAGAAGCGTTTGCGATCGCGCTTCGAGAGGACTACAGCGTCAAGGCTTCGCGACACCACGCGCGCGGGT
TGCGCGCGGGAGATGAGCCAGAGCCGATGGAGATCGGCGCGATCGAGCGCGCTGTGCCTGTACAGCGCGGCGGGTATGCAAGTGCGAGAGGGAACCGCCG
GAATAACGCCGCGGCGAAGCAGCTCACCTGTTTCCGCTGTCAGAAGATCAGCCATTGTGCTGCCGAGTGCCGCGCGCCAGCACCGGTCCTCGCCGCAGTG
GACGCGCACGNNNNNNNNNNGAGATCGATGCGATCGAGCATGCTGCGCCTGTACAGCGCGGCGGGTATGAGAGTGCGAGAGGGAGCCACCGGAATAGCGC
CGCGGCGAAGCAGCTCACCTGTTTCCGCTGTCAGAAGATCGACCATCGTGCTGCCGAGTGCCGCGCGCTTGCACCGGTCCTCGCCGCAGTGGATGCGCAC
GGCGAGCTGTCCGTCGATCCCACGCCACCAAAAAACGCGGGATCCTGGTAGGTGCGGGGCGACCTACTGGGCGAATCTGGCGGAATGTTCCCCCGGTGGC
GAGGCGACCCGCCAGCCCCGTTGCGCTACGCGCGCAGCTCAATGCCACCACCTCCAGCAGCGGCAAGCGTCTGATCGTGCTCAGTCTGCACGTCGTGGGC
GCGCGACGACCGTTGCATGCCCTGCTGGATTCCGGCGCGACGAACAACTNNNNNNNNNNTAAGCGTCTGATCGTGCTCAGTCTGCACGCCGCGGGCGCGC
GACGGCCGTTGCGTGCTCTGCTGGATTCCGGCGCGACGAACAACTTCGTGCACGCAGAGAGCCTCTCACTCCTCCCCTCCCGGATTCGTGTCCGCGAGCA
GGCAGGCAAAATGATCATCAAATACGCCGACGGCGAGNNNNNNNNNNGGCGGGAGAAATGATCACCAAGCACGCCGACGGCGTTCAGTCACCTTCGCGTA
CACGTTCGATGGCTTCGAGAGCAGAGACGAGTTCCTCGTCGTCGAGCTGAGCGGTTCCTTCGACTGCATCTTCGGCATGCCNNNNNNNNNNTCACCTTCG
CGTACGCGTTCGATGGCTTCGATAGCAGAGACGAGCTACTCGCCGTCGAGCTGAGCGGTCCCTTCGACTGCATCTTCGGCATGCCGTGGCTCGCGCGCCA
CCGCCCTGATGTTGACTGGCTTAACCGCACCGTTCAACCGCGTGACATCGATGTCAACGCGGTGCTCGCCTCGCTACGAGGAAGCAACTGGCCGCACGTC
GCGGTTGTGGGTCCAGACTCCGCGACCCTACCGCACAACGAAGAGAGCGATGGCCCTTCGTGCGCCGCGTGT