Description :
From Genome Similarity Track
Location :
Scaffold_3808:34- 2016
Sequence
1982 bases(100 bases per row)
GGTAAATTTTTGAGTGACCCGCCGTTAGTAGTTCAAAACTGCCCCAGAAGAGAATGCATCGCTCGTTAACGGACTGTGGAAAGAACAAATTCGGCTAAGG
GAGACAAGGTCCTTAGGATTCGCCTCCATCCCTTCCTTGGAAACTCGATGGCCCCAAGTAATCCACCCTGCGCATCCCCCCAATAGCTCTTAACCACACT
GATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAA
GATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGG
GCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAA
CAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGT
GCTTTATCCAAATCTTCCAACAGCTCATTGATCAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGTCGGTAATCAATGCACAGACGTA
TATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATC
CGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGTGGGCGGCG
GGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTTCTCAGATCTTCTGACGCCAGACGGATCCAACTCCAGTGGGTTCGTTCGCCCCTTGA
TCCCACTTGCGATATCATCAATCGTGACCTCCTCGGTTGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCCTCCCAGATCCTCGGCGTGTAGATCCC
CGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTT
CGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCTGTCGGATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCC
ACTCTCGATAGGGGTCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTT
CGTCCATCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCTCTCTG
CAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACC
AGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCTTCATAAT
GGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGACTACGGTAGGTACCCATTTCTCGCCCCGAGT
GACTCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCCTATCCGCCCTTATGATCCTC
ATCTTCGCTCCATAAAAGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATC