Description :
From Genome Similarity Track
Location :
Scaffold_231:34- 1633
Sequence
1599 bases(100 bases per row)
AAAACTTGGGTACACTGAGGTTGAACCCAGGGGATCTGCTGGGAACTTGAACTTGAAGTACCGCAGAGATCCCTGCAAAGTGATTGGCGGGAGCCACTCA
CTTCAGAGGATAGAGACACGTCGGTCTCGTCACCAGTGTAGATTCCCAAGTCGGAACCATCACTCTGTACTTGATTAGTACATGGATACTTGTGACATCA
TCAGATGACGTCACACGTGCATGTGGGATCTGTTGTACCGTAATCCCTTTGTTATTTGCTACCACAATGCACGCTGAAGGTGGTGTGTTCAACACTAAAG
TAGGGTACATCCGCACCTTCATGTAATGGCTAGGTATAGCCCATTACATCATCCCCTCCTTAAAGTCAAAAGTACCTTGCGTACTTTTGCAGACCTTTCG
GAGCAGTTCACTTCCCAATTGGCAATGAAGCGACCAAGTGACCAAGTGAACCGAGAAGAACTTCCGTCGTCCAAGCGACAGCGGACTGCTCCAGAACTCT
TCGACATCTTACCCATTCTGAAGAAGAAGGGGGATGTAGAGTTCTACAAGGAGCGGTTCTTCAATTGGCGTCGGGTCAACAATCGTGATGACCCGGACCA
ACCTATCGCAGCCCAGAGAGACTCATGGCGAACGTTTGTTCGTCTTGAGAACGAGAACAAGATGGAGCGTCTTCTTCGTCGTGGCAATGCTCATGCCCAA
AGAAGAACTCCCGCTGACGACAGAGTGAACCTCAGCTCTGGTCGTCGTAGTGCCGCCCCTGGCGACGCTACAAGCGGTTCTCGTAGCTGCGGACCACGTC
AGGAACATCAGACTCCAATGTCTGACGAGGTTCCCACGTGTCCGAGCTCGGTGGGTATCCACGCCACCGAACTCTGTAGAAGCGCTGATGGTTCAACCGC
TTCTTTCATGACGACGAGTCGGTCGATCTTCATGATCAACAATCGACTCAACCACCCAGCGATGCTCTCCCTGAGAGTCTAACAGCGGGGGTGGGGCTGA
ACGCCAAAACGATCGAGCGACTCTGGAAGTGGAAGAGTGCTCATCGCGCTCAGATCGAGGCATTGGAAGTTCGCGACGCGATTCTTTCTGATCGGTGCGA
AAGCCTCGAGGACCAAGTGAGGGAGCAAGAGTCGCGGATCGACTCGCTGTCCGATGGCCCCGCCCAGTATCTGGCTTTGGAGTCCCGTTTCGAGCAACGG
TTCGAGCAAGTCCAGGGCGAACTTGAGCGACTCCAAAAGGCTGAGAAGGCCCGTGAGGTATATCACGAACGTCTACTGCGCTCTGTGGAAGAGGCAGGGA
CGGCTCTTGAGGTACTTCGGACGGAGTACCATTCTCGCCTTCTCTTGCTGGAAGTTGTGAAGGAGGAGTCCTTCGATGTGCTTCAGCGCCTTTATGCCGA
GAAGAATCTCCAGAGCGATGAGCTGTTTGCTCTTCGCAATCAAGTGGAGAAACTTCTGATCAGTTTGATCATTTGCCAAAGGCTCAGTAGGATCTGCAGA
TCCACTCGGAAGGTAAGGCTTTAGTCTACCCACATAAAATGTAGGATGTAGACGCATGCGTGTAGGTATGTCTAGTGTGTAGGCATCATCATTGCATTT