Description :
From Genome Similarity Track
Location :
Scaffold_4213:34- 1364
Sequence
1330 bases(100 bases per row)
TCCAGCATGGATGCCCCGGAGGGTCCTAACGTCATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAG
CTTGGCTGACCCTCGGTGACGACACTGGATCCATAGTGCGCGACCTTTCTTCCGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTAT
GAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAAC
TTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCAGTCGTGGATTTAGGATCCGCATAACAGGATCTTGATGCAGAAAACCGC
GTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTT
CCGCGTAGTCTTACTCGTTTTAGTCGTCTTTCTCATTTCTTCGACTAGCGGGCTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCG
TACCGTTTCGCCGTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCACAGGGGTCGTTGAGGGGACCTGGGGAGGATAGAGAGGTT
TCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTT
CGTCGATCTGACCCCCGATGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGAACTCACGGTGAAATCCCGAGTCACTAAAAAGTCCG
GGCATGCGCACCATTGTGGTATAGCGGGATCAGCAAACTCTGCGAAATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTT
TCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCAGTAGGGCGGGATCTTGCTCTCTTGGTAACTTCCGAAACGTTCAAGTGGTG
AAGCTTGAGTGTCTTGGCGAGGCGTGGGGATGGGGTGGAGCAGCAGAGGTAAAATCTTCACTCTGCGTCCGCGGTTGGTTCTGGATCCCAAGCGAGTATT
CGAGCTTGGTGGATCCAGGGTCTAGATCGTGGATCTGGCCGTAGGGCTGCCTTGCGGGTGTGTTCCCTTGTCTTTGTGTTGCATTTTCGTCGTACTTGCC
GCCTCCTAGTGACGGGATCTTGAGAGTTGA