Description :
From Genome Similarity Track
Location :
Scaffold_225:34- 1353
Transcript NameFunction/comments
Phymu_g7103hypothetical protein PHYSODRAFT_485789

Sequence
1319 bases(100 bases per row)
CGGTTTGTGTGTCGTATCCGCCGAGAGCCTTGCTAACCTTGTGATCTTCTCTGCTTGTGTTGAAGATATAATTGAAGCCCTTGTTGGTGGTGCTCATGTT
CCACGCGCCGCGGTCAAAGATCCAGTGTTGTGTCAACCCGTCGCAGTTTTTCACATGCTGTGCCCCGAAAGGAATGCGACGTGAGAGCTTCCaccacacc
agcagcgaccatcactctttcCAGCAGACGCTTCACGTGCGCGCAGATCGCCGGAGCTGTAGTATCGGCAGTGACAGGCACCGCGGGAGCAGCAAGAGTG
GAAAAGTCTTCAGGGTTGCTGAGGATATCCAGCAAAGGCGTGGCAGGAGTCAAGTTTACAGCGGCGGCGACCTGGCCTTCCGGGTGATCAGTGCGACGGC
GATTGCGTGTAGTGGGCAGCTGACGAAGTCGGCGTCCGGGAAGAGCGACAGGCCCTGTTCTTCGGCTGTCTTCATGCGGATGAAGCGCATGGAGAAAACC
TCAGCCGCGTCAACCGGCAGGTTCTGTTTTAGGACGAGTGCCAAGTCGGACGCTCGTCCGAACAGGTACCACAGCAAACACAGCAACGCTGCGTCTTGGT
AATCACAAGAGGAATGCGCATTTCTATATAAATACAACATCATCTTTTTTAAATCCTTCTTTGAGCATGGTGGAGCTTTGTTCACTACTTTACCGTCTCT
TTTCATACAAAAGTTGTCGAGCGTCTTCCCATGCTTAGCATCTTTGCTTCGACAATATGTCGCTGCACAGGGAAGACTTCGAACAGCCACATTTTAGCTT
GTCTAAAGAACTGCATAGCGGTATTCCTGGAAAGAGGCTTTCCTTTCTTACCCTCATTAAAGGCTAGATACATACCAAACATATCCAACACAGACACAAA
ACACTTACCTGTTGCGTCCTGTTCAATGCACTGTTTAACATTGTCGAACGCAATATTCTCGCTCCTGACGAATGCATTGAAAACACTGATGGCGGTGTCT
CTGGCACGCTTGGTGTTGCcaggcttgagctcgtccaacCCCATCCTGGACGGATAAGACGGAGAAATTGCAAATATGCAAGTGATATGCTAAATACTTG
TTACTTGCATTGCGATAGATATATTTCCTAAATCTCTCCGACCCGATATGTCGGAACGGCTGGCTTAGAGGACATCCTACCTCTACTTGGACatgattgg
ataaaattAATTTGTAAGAACAGTTTTACTGGTTGTTTACAAATAAAAATCGAGGATTGGTCAATGTTGCTTCATACAAATTATTAGTAAAGTCGGATAA
GTTGTCATATTCATCcata