Description :
From Genome Similarity Track
Location :
Scaffold_4351:34- 1247
Sequence
1213 bases(100 bases per row)
ATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGAAACCTTACAACAGGATGTCCTA
CACCACTATCACGCTAGCTTGGAAGGCGAACATCAGGGTATTGGTCGGACCTACTAAACGGATCCGGGAATGTTTTAACTGGAGGGGACTATTCAAGAGC
GTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACGGGCAAGAGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCAACTTACCCTT
TCCAAATCATAGCCATGGATCATATCCCCTGTTGCCCAAGTGGTTCCAGAGGAAACACCAGATTGTTTGTTTTGGGGGTGGACCCTTTTTACGCGTTTGC
GTGTTAGCCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGA
CTTGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTA
ACGGGTCGGCCGAGCGCATGGTACAGACGATCACAAGAGCACTCAAGATATACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCT
CCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATT
CCGGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCTTTGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGAC
TGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTTCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGT
GAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGCAGGT
ACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCG
ATCGCGTCGACTT