Description :
From Genome Similarity Track
Location :
Scaffold_2393:34- 1180
Transcript NameFunction/comments
Phymu_g14088reverse transcriptase

Sequence
1146 bases(100 bases per row)
gctccagacgtgTGCCCTGCTGATGAGACTCGCGTgtatgctgctgctgaagttggGGGTGCGCCAAGTGGATCCGCCGTAGAGGCTCCGACCGGCAGCC
CAGATCCTGGATGCAGCGCAGACCGCCCAAGCCTAAGCAACAGcccagtggaagacgacgcagtgtACCTGCACGAGAGCGGCGAGTTGCATGCAGAGGg
gcaggagaaggaactggcAGTGCTGCCTGAAAccacggcgtcgacggtcgAGGTGAGGATCGAGGACCTACAAGTCGGAGATCCAGCGACCAACACTTCG
GATGAGATCAAGCGACTGACCGAAGAGATCTGGAAGTACAAACACCTGCTGATCGGAAAGGGCAATGCCCtaccgcctgctgctgtcggagcgGTGTGCG
ACATCGACGTCGGGGACGCGAAGCCGATCGCCCAGCGTGTGCGCAAAGTGTCGCCCCAGTACcgcgagaagctgtcggatcTCATCAAGGAGTTGTTGCA
GGCCAAGATCATCCAAGTGTCGACTTCGCCGTGGGCGTCGCCcatcgtggtgatcatcaagaagaatggcGTGGACATCAGACTGTGTATTGATTACAGA
TTGGTCAACAGCCTAACACGATTGATGGTCTACCCTATGCCGTTGATCAGTGACTTGCTTGAGGATCTCAACGCGGTTTTGTGGTATTGCTCGCTGGATA
TGGCGAGTGGCTTTTGGGTGGTTAGCAGGACGGACCGCGCGCGCGCGATCTCAGCTTTCATCACCCCGTTTGGCCTATTCGAGTGGAACCGCATGCCCTT
CGGACTGAAGAACGCGCCGCAGATCTACCAGCGACTACTGGATAACGCTCTCTACGGTTTCCTGAGGGTCCCACCTGTCGACAAGCCAGGATCAGTGACG
GACCTCTTCGACGACGGGATCCCTGAGGTGGACGGCCTGTCCTCAGTGTTGGGGCGCCGATCCTATATCGACGACATCTTGGTGACGGCCGGATCCTGGG
ATCACTTGTGTGAGCGAGTGCGTCAACTGCTGGAGGCATGCGACTAGTGGAACCTGTCCATCAGCGTGGCGAAGAGTTACTGGGGCTTGCGGAAGGTAGA
CTACCTCGGTCATCAAGTCTCCGACGAAGGTCTGGAAGCGAACCCG