Description :
From Genome Similarity Track
Location :
contig_114:3399- 4400
Transcript NameFunction/comments
g11350.t1hypothetical protein PHYSODRAFT_247933

Sequence
1001 bases(100 bases per row)
TGATTTACATGGGTACGCTGGTGCGAGCTGGCCGTGGGAGAGCTGTGGTGGTCGGTACAGGCTCCCGCACCGAATTCGGACAAGTCTTTGATGTTGTGCA
CAAGGTGGAGGAACGCAAGACGCCGCTGCAGAACAGCATGGACACGTTGGGCAAGCATCTCAGCATGTTCTCGCTTAGTGTGATCGCAGTGATCGTGGTC
ATTGGAGTGATCCAACACAAGGCATGCTCACCATGCTGCAAATTGGCGTCTCGCTGGCTGTGGCGGCCATCCCTGAGGGCCTACCAATATGTGTGACTGT
TACGCTCGCATTCGGTGTGATGAAGATGGCCAAGCGCCATGCCATCGTGAAAAAGCTGCCTGCCGTCGAGGCGCTGGGATGCATCAACGTGGTCTGTGTG
GACAAGACTGGCACGATCACGACGAACAAGATGGAGGTGATCGAGATTTTCGTTCCGTTTGAAACTGTGACCGCTGAGGTGAACGGTATTGGCGAGCGAG
TGCGTTCTCCATCACAGACGCTAGATATGCCCAAGAAGAGCGCGCGTTCGGCTGTGACTATGCGTGGTGAACCCGTTACCGAGGAATCCCACCCCCATGT
TTATCACTGCCTCCTATCCGGTGCGCTGTGCAACAACGCGACTATCGTGGACCGAGAAGTTTTGGGCCAAGCTACGGAGGGTGCTGTTTTGTTGTGTGCG
CAGAAGGTGGGGATTACCCCATCGGTCATTCAGCAATTCCGCCGTGTTAGCGAAGTTCCCTTTAGCTCGGAAAAGAAATGGATGGCAGTGTGCTGTGAGC
CACCGATGGGGGCCCTTCTCGCTGGTACCTGAAGGGTATGACGGAAGCTATCTTGTCACGCTGCGATAAGATTGAGGATAATTGCGGCCGCGAAAAGGAA
ATGACCCCAGGAGACCGTGAACGCATTTTTGTGGCGTCCCAGCAAATGGCGGCACGTGGACTTCGTGTGTTGGCATTATCGTTCGGTGAGCACTCAGATC
G