Description :
From Genome Similarity Track
Location :
Scaffold_8:339896- 344571
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003768Similar to Ubtf: Nucleolar transcription factor 1 (Mus musculus)

Sequence
4675 bases(100 bases per row)
GACAAATAAACATAATCTAGAGGCTTGCTTTGATTACAATTATGGCCTTGGGGCATATGACGCTAAACAACAAAGTGTACAGGTACGTGAGCACGCGTTT
CATTTTTCTTTCTATTCCTGTAGGCGTTGTTGCACGAGCGCGACGAGCTCGTCGTCGGAAAGCGCGGCGGATTTCGCCCATGGCGGCGGTGCGAGCTGCA
TGCGCTGCATACTCGCCATGACATTCTGTCTCGTCGCTGCGTCCCATGATCCCAGTGCAGGGGTTGACGCAGCTACGCCCTCAGGACGAGAGCTACTTGC
GGAGTCGGTATTGCTGTCCTCCTCGTCCTCGTCTTCGTCACTAGCGTCGCCAAGCAGCTGGTAATACTCGCCGCTATCGCTGCTTGTGGGTGACGCCGCC
GGCAGCAGCGCATACTCCTTTGGAGCATCTGCACTGTCTTCTTCTTCGTTCTCTTCGGCATCGCTGAAGTTCTCTTTCAGTGTGTCATTACCATGTGACG
CACTTGCGGATTGTGCAACGACAGCTGCGTACTCGGCCTCGAGCCTCGCGAGCGGATCGAAATGTGCGAGGAAGCGCTGCATCATGGACTCGTCCAGGTC
CACGAGAGGCGGCTCGTGCGGCGGATGCGCACTGTCGTGGTTGCCCGCGGGATCCGCAGCGCGCGCATTCGCACTCAGCTTCGTATAGGTGGCGTCCATT
TTCTTGCAGCTTTTTTAGAAATTATTATGGCATTATGGCAAAGGATCCAATTAAGAAACTTCGCACAGTAGGACTTGATCTGTCAGTGACACAAGGATAG
CAACTCTCGGATTTCTAACAGATAAAAATTTATGGTGTGATAGTACACATTAGCAGTTGTTCTTAGAGACAAGCGGTAGGAATTTGGAGGAGGTAGTTAG
CAACAACCGTAGAAGATTACAGTGGTAATCGTGTTTCGGTGCATGTTGGCAGCATGAGGACGGTGAGCTCAAGAAGGTGTGTCTGTTGTTGTGTCATATC
GAAGAGGAAGCGAATGCAGCAAGTTGAGTCGAAATGTATCGTGCCTGTTGGATACAGCGAGCGAACCAACAGAAAACTCAACTCCTTCCTCAAAAACAAA
AGTTGCGATACCATAAAAAAGGTTGTGTTCAAATTACAAAGAGAGCAACAATCTCAATACAACTAACTCTCTCCTGTTTGTTCAAGAAGAAAGCATCAGA
TATTGCTAATAGAAGAGCCTCATATTGACGTAAAGGACTATGCTTGTACTTGAACTAGTATAAAATATCACCTTGTAACATAACATAACATGCTTATGGA
CCCTTTCTCTCGTTGCGTGTCTTCATCACCTACTTACAAGAACGACCAACTGTAGCTCTTGCGCACGCTCACCAGAAAAACAAATATACCAACGATAGAA
GAACAGGAGCGAATGTGAACAACGAAGGCACGAACGCAACGCGAAGATGCAAATGTTCCGCCCTTTGAGCAACTGTGGCGTACACGTTTGGGATGGCGTC
TCCTGTATACCCACATCCGAACTTCGAAATAAAAGACGAATCAACCAAAAATCAGCAGCTTCCACTTTTTTATGTGGGCAACAAAGACTCCACATGGCCA
TTTTGGAATGCGTTATGCTGAGAACGTTGAAGTTGCTGTTGTGTTTACTTGATACTTCTTTTTGTTAAATAACATCTTGGTGACTTCCTTCGTGCAAGCC
ACCATCACCACCACGAACACACATGTCTACTTTACTCTAATGACCGACTGGTTCACGCGCAGTGCATACCCGCGTGAAAGAGCACGTCGTCGATTGTGTA
CCGCTTCGCGGGGTTCACCTGCAGTAGCCCCGTGAGCAGGTCGACCGTCTGCGACGACACGTTCGCAGCCATCCCCCATGCCTCTAAGATCTTCTCGACG
CCAAAGGTCTGGAGCGCGCGGAACGCTTGCTCATGGACAGATGCCTTGGGCGTCAGCGGCGAGCCCGTGATCATGATGAATAGCATGATGCCGAGCGACC
ACATGTCGGCCGCCGCGGGATCGTACGCCTGCTCCGCGACCACCTCGGGCGCCATGTAGTACGCCTTGCCGACTTTCTCCGTGCACACGCGGTCGGCTTG
CGTGCTGAGCCCAAAATCGCAGATCTTGGCGACGCTGTCGCGCACGAGTACATTCTCAAGCGAAAGATCGCGATGCGCAATCCCGTTCGCGTGCAAGAAG
TGCACTCCATTGACGACCTGGCGAAAGCAATGCAGCGCGAGCCGTTCGGGAAATCGCGTATCTGGCGCCGACTGCAGCAACTCGAGCAAATCGCCGCCAT
CGCAGTACTCCATTACCATGAACCACGAACCGTTCTCGATGAACTCGCGCTTGCACTGCAGGATGTGGTCGTGGCAGCCGAGCTGCATAAGGTTGCCGGC
CACGCGGCGCTCATCCCACGGGTTGTCCATGTGGGCGTTGACTGCGAGCGCACGGCGCGCGACGCTCAGTGACACTTGCTTGACCGCGACGAGCTCGTTC
TTCTGGCGCGCGTCCTCGCAGAGCCACACGCTCCCGTACAGCGCGTCGCCGATCTTCTCCTGGACGCGGTACTGCTGGCGCAACATGACTGCCTGCCTTC
TGGCTCAATTGATTATCGGATAATAGCGATCGCGCTATTGGGGACTGTACGGACTGTGTGACTTACTCGTGCTGGCGCAAATTGGATAATGAAAGTGCAC
AAAACACACTCGCCCAGGACAAAGAGTGGCCCCATATGGCGCTGATATTGCGCCTGTGCAAGTGGGAAAGGGCGTCATAAATGCCATGGGCCAAATAGTA
TTTCGAGTTTGAAACAAAGAAAGGTATTTTAGCGTTTGCAAAAGACTGTATAATTGAATTCCCCGTAAAAAGCAACCGTATGACATTGTTGATGAGTATT
TTTTTTAACCTTTATAAAATGATACATTAGATTTTTCTGACAAACAGGCAAATATCGAACAAAAACGCGACGTTTGGATGAGGGCTGACATGAAATAAAA
CCCGAGCCCTCCACCAGCCTAGAAAATCGAACAACAACAAAAACAACAACAAAAAGTCCAGGAAATCCAAGTTTGAACCTACAAAAAAAATCGGACTGAC
GCTCGAAAACATCTCGGCAGTTGTTAGCCGCTGGCGCAAACTAAGGGACCACATGCACACAAACTAAAGTGAGACGCAAGCAGATCTCGCCGTTTATACC
AGTCGCCATCACCATTATATATACCGAAATGTTTTTAGCGACGTTGTGATGTCATGAGCTCTTCTGTATAGTTGTTTTTTCTACATGCCTAAACCTTAGA
GATCCAGACCACCACGATGACTGCAATCAACGTTTGATGTTGCATCTCTCTGCAACAACATTGGCTGGCAGCGGTGAAAACGGAACATTATTACAAACCG
CGATTTCGACCGCCGATTCTGAGGCATCACCTAAGAAAATAACGGCCAAAAAGAAAAAAACGTAAACAAAACCACGGTTCACCCATGCGTTCGCACAGTA
CAAAAAACTCACGCCAAAATAGATGTGGTCCATTTTACGGCCCGGAATTTGCGCACAGCATTTCGCTGACCACGTGTGCGGCCTGGTCCAACAGCCTATT
TTGAGTTTTGGTTATTCCTGGCTATTCTTCTTCCACACAACTGGCACAAGACGGACTACAGTATAGTCGACTGCAATAAGGCCAGAAAATTGTATTCTTT
GCCAATCTCGCTAAAATATATTCCAGTTACGGTTGCCGAGAAAATGTACACTGTGAGAGCTGGACTCCAATCGGTTATGTATCCAAGCAGACGTTGCATT
TTCCGAAAACGCTTTTCTAAATAATATTTGAGATCCTAGCGAGAGTAGGACTTGGAACTTTCTTTAAACGTAACACAGTATACTTGACCTCGAAGAAAAG
AAACTGACGCCAATTTTATTTGCTTGGTAACTATGGAGCACAGTAACCGTCCCAGTTCTGATGTCACTTACATGCGCATCTTCAGATACGTTGTGGTTTA
GGAACAATAGTGCGGGGGCACAACTACAACTGCAGTCTAGTGTTGTCGACAAGTACTGAACAAGCAAACGTTGCTCACGCTGTCTCTCCGAGCTCTGCAA
ATAAAACGTATCCAGTCGTGGGAGAAGGTGGCTCCGCATCACGCAAAACGCTCGTACGCTGTGCTTTGCTGCTCGAATCTAGATTGGGGAACAACGTGGG
ACCCCGACGTGAATGGTGCTATCAACATCTCTAAGATTGCAGTGCGTATGATGCTCGGGTTTCTCAGGCCTCTAGAATTGAGTCGGTAACGTGGATCGCG
GGAGGAGATTTCCTCTACACGCGTTCACACGGTAGAAGTAGTCCGTATCAGGGTGTGTATGCACTCTCTCCTTCTGTTTACTGAATAGTTGTTATAAAGT
GAGGTATATTTAGGCACAATCCCTGACCTTCAATATCCATTCTCCTGCTACATTCAGACGCAACTTGGCTCTACAACAAGGAGTACAGGCCGGTTTACGG
CACCGCAGGCGTCGTTCCGGCCACTCAGACCAGGTAGTTCTGGACTAGTATGGCGCGCTCTCGCACGTCAATCTGAGGATGCTTGCCATTGTCTCGTTTT
CGCGGGTTGTCCATGTGTCGATGGATCCAATATACTGCGTCGCTGGACATCGATTGCTCGATCTGTGAGACGATG