Description :
From Genome Similarity Track
Location :
Scaffold_327:33987- 36590
Sequence
2603 bases(100 bases per row)
AAAAAAGGACGAGCCGCTTCTCTGATGGCTTGTCGAGGTCGACACTGCCATAATGGCTCATCAGTGATATGTTGCGCTCGCCACGTCTTGTCTTAGTAGA
CGAGCGAGAAGCTGGCATATGTCCGCCGGCCCACAGATCATACGTGCTTTAGCACATATACGAAATTCAAGGAGGAGCTTAGAAAAGCGTTTGGACCCCT
CCCAGAATGTGTTCCGGCCGAGAGCAGCGTTTCTCGACCTGCAGCAAGGTAAGCATGACGTTCATGCTTACACCCAACGTGCGCGGTACTTGGTCTTGAA
CATCGTGACCAATCCGATAGACGAGGCGACAAAAGTTGTTACGTTCATGAAGGGCTTGAAGAATGGGTCGGTTAAGACCTATCGCTTCTTAGAGTACCCA
AGTACTTTCGAAGCTGCGATTATTTTTGCGATCCAAGAGGAGTTTAACCTGAAGCAGACTAAGCTGCACGCGAACGTGCCGAGGATGGCACGTCCGATGC
TGAGAGCGGGAGCTCCAGATCCGTTGGACCTCTCGAATGCTTCTGCTGCTGGACGCCAACAGCGTATTGGGGGACAAGTGCGGTGTTACCTGGGTGGGTA
CATCGGACACTTTGGGCGTGAGTGCAGAGCGCTTGTGCACTAGGACCAGGGGCCAACGTGGCGATGCCAGGCATCGCCCTGTACAATAAAAAAACGTGCA
GAACCAGTAGGCGCGGGCGCCCAACTGGCATTGCAGTCGCGCGTATCTACAACGGACACGCGACACCAAGGACCACAGCCCCCAGCGAGAGGGATTCTCG
CTACAAGAAGCAAGATGACAAGCCAAATGTTGTCGTCCTGAAAGTGACGTCGAAGAAAGAAGGCTATCTTCGCGCGTTGGTCGACTCAGGTGCATCTTAC
AAAATGGTTCGACTGGACAGGCTCCCGAAGCTGATATTCTAGAAAATTAAAACACCTCGAAGTGTTTTGGAAGTGCGGTTGGCAACGTGTGCCATCGTAA
GAACGGATTTTCGTACAAACACGGGGTGTTTGTGGAGGATCTTATCGTCCTGGACCTGAGCGATTGACTTGGTATTGTGCATGCCGATGCTTGCATGGCA
TGGCCCAGTGATCAACTGGGATAAGTGTACACTTGTACACTTCGGACGCAACGCAACGGAATGGGTTGCCCCTGTCAGTGTCGCGCATGCACCGCAAAGT
GCAGCCGATCCCACCGAGACAGCACCTTACGATGCAGCCTCCGGTGTTCAATCACAAGTCCTATTGACTAAGGCGGTCGTTGAGGCTATCTCAAATCGGA
AATCAGATTTGAGACACGTTCCTTCTTCAATGACCGTATCAACTCGGAATTTTGATAGATCAAGTTTGAAAGAAATTCAAGTCACAGACAGTGAATGTGA
CGCATCATATTTGCAAGGGGATCTAGCTACAAACAATAGCTGTGATGTCGGGCGTGTCAGCTCCGGGAGTCGAAACGATCGTGATTGGTTCGAAATTTTA
AAGGGCTCCGCCAAAAGGTGGCGAGGTGAAAAGGATGTATCGACTTCGGGAGTCGACACAAACTTGATATCAACATCGAGAGAAGACTCCGCCGAAAGGC
GTCGAGGTGATGACAGCGCGTCAGCTCTAGAAGCTGATGCCGGTTGCAACACTGAAATCGCTTGCGTGCTCGCGTGCAGCCGGCCGAACGACGAAGAGAA
ATGTAATCAAGCCGGGCTTAATCATTCGCGTCCGCAGAAGAATCCGTCGACAACTACAACGGAAATACGTCCAAGACCGGACCTGGACGAGAACTATGTG
AAGACGGACTTCACAAGAACAAGATGGCGCAAGCGACGAAATCGGCGCAAGTCTCGGTCCGGGACTAAGGCGATACGAGCGATATCTGCTAGGAGAATTA
GAGAAGACGTCGTGCGGCGAGACGATAAACGTCTCTGACGCGGACCCGTACTGGTCTCCAGTGCCGGTCAGTGGAATTAGAGAATCCTCCGACGAGTGCG
TCAGAGTTGACGTCGCTTTCAGTCATGGGCTGGATGCGCTTCACGAAGGACCTGCACGATGGACGCACCGAACAGATATGCATCGTTTCGGATATCGAAA
GGGTGAAAAGCGAAGCGGAGGAGGTGAGGTAAGTCTACACTGTGAGTGCCGCGGAGAGTAAGGACACTCTCAGCACGAATACGAACAAGTACCGCTTCGA
CGAGCAGAGCTGGGACTCGGTGAAGTCGAGTCCCTTCTAAGATGTTCTGCTGGAGCCCGAGGATTTGCTATAGAGATTCCTGTGGAATCTGCGCATAACA
ACAGTATACATCATGATATCGACCTCGTGTCGGGTACAAAGTACTGTGTGGCACGGCAGTGGCCATTGCCGCGAGATTAAGTAAAGGCTATCGACTTCTT
TGAAAGTCGTCGTAAGGCAGATCAAGTGTGGGGAATCAAAGGCCCCCGTGTGCACCGTTCATGCTTACAACAAGCCGAGCGACGCGGCGATACCGGCGCA
GACGCCGATACCACGAAAAGATGATATCATCGATTCGATGGCCAAACGCACCATCTATAGTGCTCTTGATCTGCGCGACGGGTTCTATCAGATCCTGATG
CGT