Description :
From Genome Similarity Track
Location :
scaffold_12:339860- 342435
Sequence
2575 bases(100 bases per row)
TACGACTTTAGCCTACCTACATGATCTGTAGGATGTAGGCACATGCGCGTATGGATGGCTGTGGTATGAACATCTCCATTGTATTTCGACACCTTGAAAC
GTCCAATAATTCTTGGCAAGATATTTTGCTTCTCAAATTGCGAGATGCATATTCAGTTAGATTTGTTGTGCTATGTAGTACGACACATTGACCCATATAC
ACATTTGTGTTCTTCCTTCCAATCTTACCTGCTTGTGTTTTTTGCAGATCCTAAGCTTCTGCAATTGCGTCTTGAACAGACCGCACAACGGCTTGCCTCT
AAGTGTGTGACAGCTTTTAAGCCTGACTGTGGCTCTGTAGCCATACTCCATTCCTCATTTAAGGGAGAGACCTTGTCATTTATGGAAGCAGGTACTCGAA
GATGAATACTATTGCTCGCATGAAATGGCAATATACCTTTCGATACATGCGTGGGATTTTTCAACGCAAACTTCGTGAGAGGGAGAAACTATTTCCACTC
TATGTATTGACGTAGCGTAACTATGCAGTACGCTCTTCACGACTTGATCAAAACGTTCTCTTTGACCGTTCTTTTCAGGGTGTGCCACTGTCGACTGTGA
CAATTTAGATCCAATATTTCAACAATTGCACGCCAAAACGTTGACGTGAAACGGGCTCACGGTCAGATACGATCTCAAAAAGAAGGTCATTCAGGCGGAA
AAcaacgtcttcaaagaccttagctGGTTTTAATATAAATTTACCTAAATACACGCAGGATGAACTATCTTGCTAAATCGATCACCAACTTAAGCATGCA
ACTACTGTCCATGTGTGTCACGCGGAAGTCCGGATATGAAGTCCATACTGGCAGACTTTCAGCTGTTAGTTGGCGCTGCCAACGACCAAAGTAGGAAAAC
CGATTGTTTCACTCTCTGGCAACTCTCACAGAGCCGCACATACTTGCGCACCTACTAATTCATGTGTGACCCATACATAGTATTGAGAAATGTTTTCTCA
CGTCCATGATGGCCAATCGAAGGGCTGTCTCGGTACTCGTTATAGAGGCGATGACGCAAACTAGTCATTAAGAAACAGCAAATCTTGCTCTATCCCGTTT
TTAACCTCCTGGTAAATGACTTCATGATATATTCCAAAACGATAAATAAGCGATTGTGTACGAGAAGGAAGACCTTGTGATGTTTTCCTTACAGTATCCG
AACAAGTCCGGACGTGTCTCATCGGACTTATACGCGTTGACAATTTTTTCGCGCACTGCAGTTGCAGCTTGCACCTTAATCTTTAGGAAAATTTTCGAGT
TTTGGATATGACTCGAGTATGTTCTCGCTCCTGGAGTTTGAATAGTTGTACGAATGTAATGACAACGCATCGTCTTAATGGTTTGTTTTCCTTAGCTTGT
AGTGTGcaacaaagttgtacttCGCAAAATAGGAAAACCATTATGCCATTCTCCTCAATTTATGGGACACCTTACTGTCGTATGTAGCAAGGCACGATCT
GTAAAAGTCGCAAAGCTTTTCTCTCCAACGGTACCTGACAAAAGCATACTTTATTGCTAAAATCCTTTTTTCATGAGCTAAATACTTTCGTTCTGTGGTC
GGTTGGAGTTGTCAGAGCTGATACGAAACGAATCGCCTTCGACCCTCATCACCGTGTTGCATCAACACACAATCAATGACATGATTACTTGCACCGCAGA
CCACATAAAAAGATTTTCGTCGGTTGCAATCGCATGAAAAGAATCTCCACACAAGGTCATTGTTACTTCGGCTAATACCTCCTGGTGTCCTGCTAATCAC
TTTCTCTTAACGTTTGTTCTAAAAGAGTTGTTCGATGTTCCACAGATGGTGCCTAATTGCGCAtaaatttgtgcaaatagttggccAAGCCCAACCTTTG
TGCCAGCTGTTTGACATTGTTCGGAACAGATTGACTCTAAAGGTATTTTCTTGCATGAAATGGAGGACTTGGCGAAGATAGTCAAGGTAAACATTGACAT
CAGACTCCTCATCCGTCTCGTACTAAGAGCGAATACATAGACAAAGTAACTCGATGCAACTTTTCACAATGGACGGAAAAGATGCGTGATTATTCTCTCG
AATGTAGCGGGAGCGTTTTTTGAGACTTGTGGCATCACTAATCATTCCCACAGTATACCACTGGGCGTACTGACTGCAGTTACTGGCGTATCATTTTGCG
CACTCGTGTCTGTTAGCAACCATTTTTCATATCGATCGCACTGAAAAAAGTACTGCCGCCATTTCATAAAAAGTCAAATGGTTGCGTGGAACCATGGTAT
GAGCAGGTATGGTCGTATCGTTTGATTTGTTGGAAGCGAAAAATATGCACCAACCACCAGTTGCCTTCTTTACGCAAGAGGTGGGGCACAATGCGGAGAC
ATACTCTTGCCCACATGAAGGAAACTTTTGTCGCTGTACAACGACTTGGTTTTTATTACAATGGCGACTGCCGTGTGAAACTATATTGCGTATCAGGAAG
TATGTCAATTTCATGGCGAATGACTCTGCCAGATTACAGTCTGTTTGGTACCTTGTTTGGGAATATATCTTAATA