Description :
From Genome Similarity Track
Location :
Scaffold_595:3398- 5964
Sequence
2566 bases(100 bases per row)
CGGTCTGCGGATGATCCGCTGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAATTTCCCAGTGAAGTGGGGATCTCTATCAGA
GACAATTGCCACTGGCAAGCCATGTTGTCGAAGCACATGGTCGTTAAACAGCTTCGCTGTATCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGA
GCCATCTTGCTCAATCGGTCGACAAAGACCACAATGCCACTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATATTCATGGACTCCCAAC
ACCCAATGGGTACAGGCAGACTAGCCACTGGCGCCGCCGCATGTGCAGAGGGTTTGACCCGTTGACACGTTTCATACGTACGCACATAGGTGCTCACCCA
CTTGTATAGTTTGGACCACCAATAAGCCTGGTCCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCACAGAGG
ATTCGATACTTCAACTCCTCATCATGATGGAAAGCGTTACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAAGCCATTATCGATAGAATATCGAT
GTAGCCTCGCACGTAAACGTGCCAAAAATTCTATGTCCGAGTCTTAAAACTCCTCGCTCCCTAGAGCACGTAGCAAAGCTACACATTATTCATCCTTGGC
ATAAGCCGCACAGATTAAGTCAGTGACTGACGATGACAGCGTAGTGACGTGAGCAAGCTCATAGTCAAGTCGGCGCGATAGCGCATCAGCCAAAGCATTT
GCTTTCCTGGCTTATACTTCACTTCGAATTTATATTCGGCAAAGAATGAAAGCCGACGAGCCATTCTATGAGAGAGATGCGGTGACTGTGTCGCAGTGCG
CAAAGATGCATGATCTGTATAGATCACAAATGGATTTGAGCCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCA
TGAACTGGATAGTTCTTTTCAGCAGCTTTGAGCTGTCTAGATTCGAATGCAATGACGCGTTCGCGTCCATCGACATTTGTTTGTAACAGAGCACTGCCTA
TGCCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGGATCGGTCAAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGAAA
AGCCTCATGTTCGGTGTCACCCCAACACCAATTCACATCCTTCTTAGGGAGATTGGATAATGGCCGAGCCATATCTGCATAATTCTCACTGTAATTATGC
AAGTAATTGGCAAGGCCAAGCCACTTACGTAAATCTTTTTGGTTCTTTGGAACCGACCAATCGACTATGGCCCTTATCTTGGCGGGGTCCGCTCGAAGGC
CTTGCTTCCCAATGAAGCACCCCAGAAAGGGAATCTCTTCTGCATCAAAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGCGCATGCACTCGAG
CACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTTCGTTGCACAACTATGGACAAAGATGTCATCAAAGTACGTTTGTACATAGCCT
TGATGAGGTATGAATAGTCGCGTCACCAGACGATTAAAAGTAGCCGGGGCATTTAACAGCCCTTGTGGCATACCGAGCCACTCCCAGAGCATACCGCTCG
GGGTACTAACCGATGTTAGCGGAATACCGCTTGCTTGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACTTACCACCAT
ATTTTTCTGAAGAACATCCTTTCTGGGGATTGGTGTTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAGCGTGCACAATACGCCACTTACCATTAG
GCTTTTTGACACAAAAAGTAGGTGTGGAATGGGGAGACTTACTCTCCCGCACCATTCGTTTAACTCAACATCGGGTCTAATGACCACTAATTCGGATAAA
TCTCCTGCCTTCAAGGCCTGGCTAAACTCTCCATCAGACATATCGTCTAGCTCACAAAGACCACCCAAAGATGGAAGGGTTTCCAGGCTAACACTGCCTT
CAACCTGTCCAATCACTCCGTTGACAAGTGTATATAGTGTATCACTATTGTCACTATGTGACTGCACGGACGCCTGGCGCTTAACAGTTGCCACCTGACG
TCCCGTTCGTCTTTTCGATGAGACCTTACACCCCTCTGGGGTCGGGACAATAGTGTCCCCGCGGTTACTACTACTAGTAGTACGCTCTATACGAGAGCTG
ATGTCATTACCGACATCAAGTGTGGTGCCTTCACGGCCAACCGCACTCGGTGAATTCTTACGTGTCACCCCCCAAACATCAAAGGAATCACATCCTTGGT
AACTCGGCCCTAGGCCAACCATGCTTTCAGCATGCAGTGATTCGTTATCACAACGAGTAACACTCAACGTAGTACGTGCCGTATCACTAATACTCAACGA
GCTACGCTCGGAATTCATGTTTTCAACATTGGAGTTAGTTAACTCAGACATTCCAATGTCCAGCAC