Description :
From Genome Similarity Track
Location :
Scaffold_40:339797- 346777
Transcript NameFunction/comments
Phyca_LT1534120215Hypothetical protein
Phyca_LT1534120010conserved unknown protein

Sequence
6980 bases(100 bases per row)
tcgcaagttacttccctataaaaatgtaatacaaaaaatgttatctacacttttgcaaataatttattcttctatcataatttcactaacctcgcacttc
cactacaccattacaataatactcagctcacatttagcctcgcattgagctctaagcggccaccttttctggaccgtggcacccagagcaacaacgagcc
tccacccgtaccaggaagtcccaagaagccaggacgccacctatccaaataaagtgttttgccccccaacgtcgtcacgttcgatttccacgtgacagtc
tgtccagccgcgatggccacttcagcgatcttgttaccgccagatttgatattcacagtgacgtcctctgtatcgacacttgtgaaggtgacgctgacag
tcccgtcaccgaccttagtccagttaccagagctgttgttgaaagcctttttcactgtcttcaaccccagcgcttctttcgcagtaccgtcgtcgatttc
gcctacaaactccgtcggaccgcaaatggtctggaagaactcggagatggcaccaccgatgttcgttctgtcccagacagcgtagaaagttgcagcttta
tccgcgatcttgtatgcgtattgaccggcggtcagaagagaaccattgctgctcgttccagagctgatcaagtcatccataatgcctctcatacctttgc
gtaaggcttctcgagtggtgtaggccgtcgcctcgttagactcagcaattagctcctccatgcagttgttggtcaccgtcggaatttcatacagcgcgag
gttcgacttgctcattgcaacgcggatgtcgtcctcagagatccttggattctgtcgacggagttccgctacgatcatccacgttcgatccagcagtcgc
ttcatatcgtagccgcaagtcgagttcgatttaagagcagtctccaaatccgtgatttccgatgacttcaacgagctaatcgagtctccaagggtgatat
tcttcatgaaactcgtgaaagcactccaactggacacaatagcagctccgttggcgagaatatctttcagcgcaagctgaatggtgttggtgagtctatc
tgcgaacttgaattgatcttccactttgatcccgaggcacgacatgatagtgatcgggatgtcaaagaccacattgtcggtctggtacaacatagtgagc
agcttgtcctgggaggtctgtgggtcggacacttcgacagttctcacgtacttggacagggccttgactaatcccatcatctccttactacacttgaacg
cgatctgcagtcccttagccatgagtttgaactggccgtacaaattgtacgaagcgagagaaaaaaccgcttggcccaccgaggaaattttactgacgac
ttcaagcgcgcagtcgtcattttgtcggatgcactcgactccacactcgaccgggtacgagaatgggcattgagcccaacatgttccaagcttcccatcg
aagcccaatggacacgttttggcaatgtgagcttcacggtagcacgcagtgtcctttgcagttccaagagcagagcctacccagttcctgtacgtagact
cgatagtgctggtagcattgagcgggttaccaattgtaaacccagtgctcgagtcgctatcgtcgtcgctgtccgacgaatcgctgtctgccttgtcatc
ttggctatcgacagactcatcgtcactgtcgtcctctattgccgacctgaaggagatcgtagcatcggagaccgtcgccgtgtcatttactgtgaaatta
gcagtagccaccgttgcaattggcactgatgcagcacttgtgttgaatgtgtaggactgtgccgaagcttgaacaaagaggaccacgacaagtatacatg
aaaataccagtaacctggtcatttttgctaaacgcagcaaaaattagaatgccattccgtttaagcaaaccgccaaaacaacgtcgcgtctatcttggca
tgtggtgaccgtctcaatacggcagattcatgtcggtaatgtaacgcagacttcagcctgtttcgaatctactggcggcgtgacgacgaatctcgtaaga
tggatcgcaatcttgcggtggtcaaaacagttcattcatgtgcccagatggccatgcaattaattgtgggcgacgggaagcatgacttgagccgactcca
ggattcagttggctagcgctaaagctcgaggagaatctacagccaccacatcccatgacgtggagagatacactaggattgggtagatatagatgagacc
gtggaggcgaaggggtgtaatgagatgtcaaggagatttgcaaactgtagattcgaccagatgaaagcttcagtctggaggctgcttcgtgcagttgcgg
tgtgtatcacgtgccttggtgaggcgggcaaaagcctcgacagaccgtctcaaactcagcaatcgacctttacaaatttgcgttagactggacgaacagc
gaatcctccagggaatgatctactgttttcgctagcagtcgctcctgaatcgtgaactgctgggctgggagcaagttctggaccaccgtgtaacacgatg
tgatccttgtaccttggcacgttgcctagctaccattgctttcgacctggtagaatctaccagagatgcagaattcccccacaacgcgaccttgtcgagg
tagctttcatggcaacgcgttgcttgctcaaacacacccaacgcaaacacgagcacgcgtcctgtatactgcttaagagatttatcccaaggtttgtttg
gacgcaatccgagtattcctcagctttcgtaaaaactcttgtcgcgacttctggtcgttgtagtgaatcgacccatcttcttcgtcttggtacccaatgg
ctgctggtgacgtattgatgtccaatgttccacttccatcgccgatgtcattttgctgatcgtacgaaagcgcatccatttcgtgagccaacaggaaatc
ccgaatcttagcgatctgtcgtcgctcctgtgggaaccctgagttcgtgtgctctgatcgctcaaatgcacgctgaaacttcttagatgcgtgtggcaat
gcgggtatctcatccgtcgtagtaactcttgctgatgccgatggatccagtaccgtgatcaccggcaccaacgctgttttgttttgtgtgggaagtaaag
gcagtggtctggaacatcaacttgcagttttgagacagcaatttcacatccaggccgacgcaaatccagctcccgtgctagatacccagagaccctcgct
ccagttgcacagtgttgcagcgcaacgtccaaaaagtcatgccaccgcgacctgcaattagacggtaacctcctcagtgatccatatcccctttttgaac
tgttcatctagttgatcgactcaccgctgcccaccacctgccctgacaggaggaatacgattttccagttctggaagcggatagtcgtcgaaaaagacgc
agtcgaactggcccaacgtcggtagctgctgttgccacgacccggccacaatctgcacattagtatggcgttctgcaaactcctgggcacgttgcaacgt
ttcttgatcgcattcgattatggtgtggctctgtgggtggaatgtctggatgtgagacgccgaataggccaacccaaagccgatttcaagcacgcgatcg
gttggcagaatggcaagcgcgtccacacacgtctccatgtattgctgctcccacttcatcatgacctgctgaccgcaagagctccagagcacctcgtgcc
cgagctcatccaatcccttcctgttgccatgcgttgtcattaatttttgtgtgatattttactacatgttgttaagcaataatgtcaaaacattaaaatt
ggccggacaataatttcaccatatttcaaaaatataattcattgtgatttaaaagttttttaaaatggttctttgcttaataatttactgttttattgtt
ttcaagttccagctcagcttgcattgagcatggcagtaagatcgagactcccttttgtagaatggggaacccacagcaacagcgaaccacctccagttcc
aggaagacccagaaaacccggtcgccatcgatccagatacaacgtcttccccgctagatccgtcacatttgccgtccacgttctgcttttgcccgctcga
accaacacctcggcaattttatccccaccagacttgatattgacgctcacatcctttgtatcgacgctcttgaagttgatggtgacaataccatttccat
tcttggtccacataccactactatggttgaaagcatcctggacaatggacatccccaaggacttatccacagaaccgtcatctatttctccgatgagctg
tgtaggcccacaaatgggctggaaatactcggacacaataccaccgactgcccacatatcccaaatggcatacaaacccatgaccttgtcagcgatgatg
aacgtgtactccttcgtggtgaggagcgtgccgttactactggttccagagctgatcaggtcgtccacaatacctgcgaacgacttgcggagcgtatctc
gcctcttgtatgccgtctcctcgtccgtttgagccagcaactcgttcatgcagttgttcgtcgcgattgggatgtcattcagcacgaggttggacttact
gaacgccactcgaatgtcgtcctctggcatttccgggttatgtttgcggaactctgctactgtcatccacgtgcgatccaacagacgcttcatatcgtac
ccgcaggtggaattcgactccattgcggacttcaaagacgtaatttccttctcacttagggacttgacggtctcaccgaacgaaatgttcttcatatatc
cagtgaatttctcccaactggagacgatcgcgtcggggtttcgcatcacttctcgtaggaccaactcagcagttgtgaccactctgtcggcgagtttgac
atcatctgggacctttttacccatacaatacatgactgctactgggatgtcgatcaccacgttgtccgtttggtacaagatggcaagcagtttttcctgt
ggtgtctcggggtcttttgtcttgacgtagcgaacgtacttgatcagcgacttagtgagactgagcatgctcttaaaacacttggtggctcgcacgatac
ctttgcccagcttgtagaagttgccaaacacattcattgtagcgaaagaaagggtcgtctggaccacagtgatcactttcaccgccacttccaacgcgca
gtcgtcgttctgacggatacattcgaggccgcactcgatagggtacgcgtacggacactgtgcccaacacgtcttggtctttgggtgactaataaacccg
acaggacacgtgttcatgatgtgagcttctcgataacaagcggaggcaattgacgtatccaatgctgtcccaacccaattgacgtacgtaggttcgatcg
tactgatagcacccgcgatgctgccaatcttgaaagcggcatccagagatccagaagtgtccaaagatccactggaatcgtcatcactgtcatcaatgct
atctgaagaatcatcatcactgtcgtcgctatcaaaagaatctgaatcgctttcgcgcctggtgatatctcgatcaccatcgttcgccaataatgaggtt
tggaacacgctttcggttgagtcttcagactcgacatcttgactatcggacgaaccgtctgcccgtcttggcaccttggtcgttctcagtacacctcctt
ccgtgaaattgtcgctcgtcggcactaccgtggccactgggcttgatgttctcgtccaagtgttaagagttaggatcttcgcggaagatatccccaaaaa
gatcaccgcgatggtggcgagcagcagagccaccttgttcatgttgaggaggtctcgcctcagcgaggaagcttgttgagctctagtacggcaaaacgag
gagtgaggggcgtcgacaactgccgaaactctgctctcgacccgagtttttttgtcgcgaaggctgttttggttggatgggcgcgcctagttaataacac
gggtcgattggcaggaacggggtgtcgatttcgccagatgagcataccgtgttgtaaatcaattccggtggacaggttccgatacatgtcttcaagcgaa
gtcgtccaatcaccgcggtaaggatcgactgtgctcgtcgacgaatggcacacgatcttccgcatacccatctggaggcaggacaagtgtcaccacgccg
cgagcgtcaccaacgcaaaggcaccacctcctgcagtcgcctggatgttgcacgttgcttgaaatatcttgttggaagcgagagacaccgcgtcttgtgt
tgagatccggagggagatcggccttggccgttctcatcaaaaggtgagacgcgaacgcagcgtagattcgctttggaccgcaatttacgacttgcaatac
gctggttgccagtggttttgcgagctgcaatgcaaccgcaacaaagttataatacgtggtgtggttgtgagatcatagtggcgatttgcgttgacctttc
cgctgttcgatagccggctcaaggcgagttactgcagtgaccaacaagcgattgcattatgcaattgtcaaggtgtgtacagtattgctgctgggaagta
catgtagcaggcgaaagcgcatcctcaaggtcttgtgacgcatgtcgcgtcgctgttgggacctcactgaggtgtctgcattgctgacatcgatcgagag
agtcttgagcacatccacaccttgatttgaggtcctcgaagttcgacttgagtgcccagtctgtccttgtgacggacgtttctccacacaacaatacggc
tcgtgataagcgctggggtaccatattgagatacgcaagttgcagagactgttacatgtaccggatacatatttttattt