Description :
From Genome Similarity Track
Location :
contig_97:33979- 34990
Transcript NameFunction/comments
g10903.t1hypothetical protein

Sequence
1011 bases(100 bases per row)
ACAGCTCCGCTGAAGCGGATGAAGAAGATGACGAGAGCATGCCAGGTACGCTGTTCGAGTACTGCTTGACTGAACGTTGTACTCACGAACGTATTGATGT
TGACACTACAGCTCCCGTCCTCTTCGGCGGCGATTGCGCAGCGAGTTCGAACATTTGCTTTCCTCGGACAGCGAACCTGACATCCCCGAATGCTCAGATG
CTGAGGGTAATAGTTCGAGACGATGTGAAGATGAAGAAACGAAAGACGACTCAACCAGCTAAGTCCGCTCGATGGTATGCTTACGTTGTATTTCCATGTA
ATCGATACATGTTATTGATGCTATCGTGTACTTGGTTTTGCAGATGACCCCAACATCATCTCACCTGGAGATCGATTGGACAACTATACTGCGCTGGACT
CGGATGGAGATAACGAAGGCGACTCCGTCTACGACGATGATGATGACCTCGGTCCGAGGAGCCCGATCCAGTTGATGAAGATGCTCTTTACTCTCCAGAC
CTTCACTTTGAGCCGTCACTTCTTCAAAGAGTTGGCGGAGTTGCTGCCATCTCTCGTGGATCTGTGGACGCACATGTTCTAACGGACATCAAGTTCAATG
GATGGATCGGGCCAGAGAAGGAGACGCCGCTGCCGTACATGGACGAACCTTACGAGGAGCGACCAGCCAACTGGATGAGCGTAGACTATCCTAACATCTT
CACTGGAGAAGGCGGACCAACACTAGAAGCGATGAAAGCAGCATCGACTGCGTTGGGGGCGTTCTTTTTGTTTGCTCCTCCACAACTGTGGGAGACTATT
GCTGGGGCCAGCGATGACTACTTCGAAGCCAATCTCGACAAGCGTGTCGCTGCTCAACACGCAAAACAAGAGGCGCGACAACGCAAACAACCTAGCTTCC
AAGTCCAGTCGCCTGCAGAGATCAAAGAGCATTTGGAGAATACACCGGAGATTTCAGGCCGCGAGTTTTGTGTTTTTATCGGGCTGCTTATCGCACGAAC
TATTGCTCCAA