Description :
From Genome Similarity Track
Location :
Scaffold_15:339770- 341382
Transcript NameFunction/comments
Physo_534848DEAD/DEAH box RNA helicase, putative

Sequence
1612 bases(100 bases per row)
GACGCGCTGCCGATAGGGAAGAGAAGACGCACGCTGCTGAGGTGAAGAACGACAAGAAGGAGCAGAAGAGTGGCCAGAGTCAGGAGAAGAAGAGACCTGC
AGCTGCTGCTCCCCCTGTTGCCGTGAAGACTGGAGGAGCTACGTTGAAGAAGTTCAAGTTTAGTGGCATCTCGTTGAAGTCGGGCAACGTTCAGGCTCCT
AAGAAGAAGTCCGCGCCGTTCTTCAACGCGTTGAGCGGAGATAGCAAGCCGCCGCTTAATGGCGAGAACGCGGCGAAGAAGGAGCAGCGTGAGAAGCAGA
AGCTGCTGATCGAGGAGCAGAAGAAGGAGGAGAAGGCCAAGTTCCTGGCGGAGGAGGACGCAGTGCCCAAGCAGTTGGCTCTATGGACGCCGGTGGATGA
AGAGAAGAAGGGTGAAACTCCCGAGGAGAAGAAGAAGAGAGAGGAGCTAGAGGCGCGCCAGCGGGAGCGAGTGCAGAAGGTCGTGGAGGAAGTGGACCCG
CTGGACGCCTACATGGCCGGTCTTGTGGACGAAGCGGCTATCAACCAGTCGCGCGCGAACCCTGCTGCCAACGTGATCTCCCAGTCCGAGATCGAAGCCA
AGGGCAAGATCAATATTTATGGTACGTTCCTGCCTCCGGATGCCGCTGAGCAGTCGAGCGTGACCGCTTCAACGTCTTCGTCTACGGCTGAACCCAAGGC
CGCAACTAGCGAGGTGCAAGAGACTCCTGAAGAACGTGAAGCGCGTGAAGAGCGCGAGCTCAAGGAGTTTATGCGAGCGATTAAGGAGAAACGAGAGCAG
GAGGAGAAGAAGGCTGCGGATGCTACTGCAGCCTCTACGACTCAAACTAACGGAGCTGGACCAGAAGATGAAGAGGACCCGATGCTGAAGAAGGATGACA
CGGGACGCATCTACCAAGGATTTGAAGAAGATATTATCGGTGAAGACTCGGAACTGGTGGACCAGCGCTCAGCTCTGGAAATTCTGCAAGAACAGCAGAA
GAAGAAGGAGATCAAACCGGTGGATCACTCGAAGATGAATTATCTCGCGTTCCAAAAGAAATTCTACGTGGTTCCGAAAGAAATCAAAGACTTGTCGGAG
GAAGAGGTGGAGGCTCAGCGTAAGGAGTCTGAAATCAAGGTACGCGGAAAGAGCTGCCCGCGCCCGCTGCAAAAGTGGACGCAATGTGGCTTCAGCGTTC
GGATGCTTCAACTTATCAAGAAGCATGGCTTCGAGGAACCGTTCGCTATCCAAAAGCAGGCACTGCCGGCGATTATGTCTGGACGTGATGTCATCGGCAT
TGCCAAGACGGGTTCAGGCAAGACGTTGGCGTTCCTTCTTCCTATGTTCCGTCACATTCTGGCTCAACCCCCACTCCAAGAGAATGAGGGACCGATTGGT
ATCATCATGGCGCCCGCTCGAGAACTTGCTCAGCAAATTTACATGGAGACCCGGAAGTTTTCGAAGGGTCTAGGATTGCGCGCTACGGCTGTTTATGGTG
GATCCTCGGTCTCAGAACAGATCGCTAACCTGAAACGTGGCTCCGATATCGTGATTTGCACGCCAGGCCGCATGATCGATATTTTGTGCATGAGTGCGGG
TAAAATGGTATC