Description :
From Genome Similarity Track
Location :
contig_22:339708- 342794
Transcript NameFunction/comments
g4765.t1hypothetical protein L914_04614

Sequence
3086 bases(100 bases per row)
TCCTATCTACACCTGAGCTGCCACACAAACAAGTTGCTCGCGTTGATGGTGCGCTCGCGTTGATGCCTGGAATGCCCGCGCTGTCTGGGAAATTGTAGCC
GCAGGGCGGTGGCATCGCTTGTGGCACGGTGGAGCAGCAACTTCCGCCGCCTGCACTACCAGTGCATGAAGCAACTGCAACCACAGCAGTCCATGCCGTC
TCCTCACCGCATTCACAACCCCCGCGATCACAGCCACCACAGTCGGCCATTTGTGTCTGAAAAAGAATGTGGAAGCTGGAGTGTTTAAGTATGAATTGCC
ATGGGTGGCGTGAGTCAGTGCTTTGGAGTCCGAGTTCATGATCACTCCTCAACTTGCCGCTGAACGGGAAACTAACTAACTATCCAACGCAACGACCGTG
CACGACGCGCCTCCCCTGTAACCCGTGCGAAGAAGACTCACAATTAACTGAGACTGCAAGGCAACTTCAACTCGCTCCCGCTGCAGCTGAAGACCGCACG
GCCTGCTGCCGGTACGGTGGAGGCAACGACCGAGCCATCACCGCCACGTTGTGTACGTGCAACCTGTTGCAGTCCGCCTCCGCATCTCACTACTAAGCGG
ACAGTGTGATCAAGCAAGAACAGAGGCGAATATTTCCTATCCAAGCATCGAGACTAGGATACTTTGTCTCCGTCAATTAGGTTGTTGTCTCGGTAGCGAA
GATACAGCACCAATAGATTTTGAAACCATGCACTGCGACAGCAGAACGCTCTCGGAAGCGAACGAGTGTGGTGATGCATGTATTAAGACGGTGTCCAGGC
ATGAAGGTTGCCTATGAACCACGTCAACCAATGCTTTTAGCCGACCATCATCACTCACCGCTCGATCATCAGTGTTGTAGAGTCTACAAAAACTGCGCGA
CTCATGTCTCGCCCTGGTCAGACGTCACAGATGCTTGTGATCGGCACCACGCTGAAAATCCATACGTTTGCTCCGGCTCATTTGCACGTCCACCCTGATC
TGCGGTCTCCCATTCCCCAATCCGCCCTCAAACACCGAAGTGCCAACACCGGCAACTAAGTAAGGCAACGATGTGCATTCCCTGCTGCTGCGACGACGGT
CCTCCGGGACCCGATGGCGGCTGCTGCGACCCGTGCGGACCGTGCTGCGGTGATTGTGGCGGTTGCTGCGGAGACTTGGACTGCTGCCTCTGCGGAGCTT
TGACCGCTTGCTGCTGCTGCGGTGGCGGAGATCGCGGCCGCCATGACCGAGGCCCTCCGCCCGAGCGCGTCGTCTACGTGGAGCCTGTCGTCGTCCAGGG
AGGACCCCCGCCACACCGCGGCTACTACTAAGCCCAGGGGTCAACCGACCGACAGAGCAAGAACAACGACCAAGCAAACCCCAGTTACGTGAGCTCACCG
CCGTACGTGTAAATTAGAGCGGAAGCTTCCGAGCAATGGAACGAAATATATCCTTGAAACCTTCAACCTCAGCATCGAATTTGACGTTTGGCTGGTATGT
GTACTTCGAGTTGCTGGAGCTTGTGTCGCAGCAGCTTCCCGACGAATTTCGGGATGGCATCTTTCTTGTAAAGGTACAACCGGCTCGGTTACGTAGGCCA
CGATCTCCACAGGTGTCGGTGCGGTGGGATTGTTCGACCTGGTGTACAAGTAATCTATCCGGATTTGACATTGTTGAAATGCTCACTCACCCATACGACG
AGTACTCAAGACTACGGCTGAATTGTTTGATTTTACTTCTCAAAACTCATAGATAGCAGTGCGCTGGTCGAGGCGGGAGGTTCACTCGCGAGTTGTGCAG
CAGTCTCGGGAGTCGGTGGATGCCTGCACTCCCTTCCGTCGCGTCCCCACTGTACTGGTTGTCGTCTTCTGAGAGGAAGACTCGGTAGACGAACGTCGGC
ACTGCCAGCTGCAAATCCAAGTCTCCGAGTCGCTCCAACCTGAACGTGGCGTCTTGTGACAACGGTTGCAGCACCCGCAGCACTAGGTCATTTTCTAGTT
TATTGTGTTTCATTGGCGCAACACTTTCACTCTCCGACGAAGAGCTAGAAAACTCCTCTTCAATAGAGTGGGGCACCCATTGCGTCCCTCTCACGTCTTT
AACCTTGCTTTTATCAGGTTGTTGCTCTGGCAAGCGGCAACTTTCTCTGGACCTCGCACTGCCGAGGTCGATGGTCACGCAATCCGTTTCAACGTCCTCG
GCAGCGCGAATCTCGGCGTGCTTGAGACTCTGGCGCCTCATTCGCGCGTGCATTTGCGACTCGAAGACGTTGCGCACCGCCTTTTCGCGCTCCTCCTGCC
GCCACTGGCGCCTTCTCCGGATCATGGCCCGAGGCACCAGGAAGGCGAACGCCTCCCGCTGCTCGATGTAGCTGAGCACCACTTTTGCCTCGTTGCAAAA
GGAAGCGGAGGCGCGGGGCCTGCGCGTCGGGTTTTGCACTGCCGCTAGCTCTGCGTAGGGTGCTGCGTAAATTGCTGGCAATGACCGAGGGCTGCCTTTG
TTCAGTCAAATTTGAGAGGAAACCTTCGCGCTTCAACACAGCCTGGGTGGCTCGGGAGAAGCTACACTTTCTATTGTGTGGTGCACACAAACATCCACTG
GGTGGCACGGTTCGCCCATCATCAAAACATTCGGTTCACCTTAGTGAAGTCAAGTGTGCGCGCGTCACAGATCACAGCTGGCGAAAACGCGTTGGACAAG
TGTGCGGAATATCCAACGGCTAAAGTCTCCGTAAGTCGGCGGGAGCTCCTCATTCTTCAATTTGCCACGTTGCACCCAAGCCCAAACCACCTCCAGTCAT
GTGCATCCCCATCTGCCTCCCATGTGACGACATGGCCTGCTGCCTCTGCGGTTCAGTCACTGCGTGCTGCTGTTGCGGAGGCGGCAACGACCGTCGCGAC
GACTACAACCGCCGCCCTCCCCCGCCAGCGCGTCGTCTACGTGCAGCCAGTGGTCGTCCAGCAAGGGCCTCCGCGTCACCGTCACGGTCGCTACTAAGTG
ACAACTAGACCAGGGCGAGCAACAAACTCAAGACAACCAAGAATCGACTTGTGGTGCAGCGAACCTCCAACCGTTTCGAAAGACCC