Description :
From Genome Similarity Track
Location :
Scaffold_1296:3397- 4749
Sequence
1352 bases(100 bases per row)
GATGGTCTCGACTTCATATTCTCCGGCAACTTGATCTGTTTCCCTGCTGTCCTCAGGCAACCGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCG
TCAAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCTTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAG
GTAGTTCCAGCTCGTACGCAAACTATTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCG
TTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCCTGCAGGATCTTCCATCTCTTCCGAAGCTTCTAGGGGGTCCGCC
GAGTGTTCGTTTTCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAAAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGAT
AATCCTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGA
CGACATTGCCCGCAACGTCGACTGCGCATCCCAACCAAGAACGAGGTAGAACGGTGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACT
AGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCAT
TAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTG
CCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACG
AATCCCGTAAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTACGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTC
GTTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGC
GTACAAGCCGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACC
TCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCC