Description :
From Genome Similarity Track
Location :
Scaffold_617:3396- 7159
Sequence
3763 bases(100 bases per row)
TGAAGATCGAGATTTATTGGATATCGATCGCGGGTCGCGCGTTTGGCTATATCTGGACCGAGTCAAGGAAGGATATGCTCGAAAGCTAGCCCATATGTGG
CATGGACCTTTTCGAGTGGCCGAGAAGTGCGGCGATCACGCCGTAAAGCTGGATATCGCGGGCACGCCGTATCGTCTATTCCCAAAGCCCACGTGTCTAA
CCTGAAGCTAGTTCGCGTATTCCCATAACGCCCAACGGGTGGACTAAATGTGGATGAGGCGACTCGATTTGATTTTGATGAAGTACTGCTGCCGGAAGAT
AGTTGGGAGGGTAATCTCGACGCGGACGAGTTTGAAGTAGACAAGATCATCGATGTGCGATTAGGACGGAAGACGAGATATGGCCAAAAACACAAACAGT
ACCTGGTATAACGGAAGGAGTACAGCGACCCAACTTGGATTGATGAAGCTGATCTAAATTGTGGAGCTATGTTGCAGAAGTTCGATCGCGATCAGGTGAG
CAAGAATCGTTTTGAGGTGATGCAATCGCACGAAGAAGAAGCCAGAGAATAGCGATGATCGGAGAGCTTGAGTGGATGGGTCTATGCAGGGACGGTGCAT
AGACGGGGAGGAGAGCTATGGGTGCAAGGAGGTTGCACATGGAGATGGAATGGGATTTATGTGAATTGAGTGCGACGATCGCAGACTTAACGGTGCGATC
AAGATGAAAAGACAAAAAAGATGGAAGAAATACGAATTATGGGAGCGATCGAATGGAAATGAGAAGAAAGTATATTGAGAGATCGCGTCATGGAACATAC
CAAGTCAATTACTCGCGGTCAAAGAACTTACCAACCAAGCGTGGAAGAGATGAGCCAGGGTGGGATGCGATCAAAGGACAAAACTGGTTCCTCGAACGCT
CGGTAGCGTGATAGATCGACAAGGCAGTGATCAAGTTGGGTATGTTGGTCCGCCGCACGGAAAGGCCGGGATACCACACTCTAGCCTCATTCGGACGGGG
AAAGCGTAGAAACATGGGGTTCAGTAAAATGTCCAAATCGCAGAGACCGTCGATCATCCCTTGAAGAATCAGCTGCAGTAACCGCTTCCAACGGGGTCCA
GCATGAGATCGCCTCTGCCTTCTCACTAGCGCAAAAGCGGCCAATCCAGGATCCGTTTTACGCTGCCCAGCGGAAATCCACAAGAAATGGGTTGATTCCC
ACAGAGCTTGGCGATGGCTATCCACGAACCCTTCATACGCCTCGACCAGTTTTTCGAACCAGCCGGAAGGCTTGAAGGAGATCGGGTGTATGGTTTGATC
ATAAAGGTCCCAAGGTTGTTGATCGTAAATTGGTCAATCTTGGTCGACGTGATCAACTGGGATGACCAGGACGACTCCGGAGGAAGGCGAACTTTGCCCA
GTTGGACCGGGAAGATGTATCCCTTGGGCTTTGAAAAGTGATGATAGAAAAAGTCTATGTCCAGCTCTGATACGCTGATCATGCTCACCCTTCGGGCGGA
CCAAGGGGGCACATCTACTGCCGATCGCGGAACCGATCACGATACCCCGGAATCCAACGATCGCGGGGTATGTGGGTGTCAGGAAGTGCCGAAAAATCTT
CAGGAGTCAGCAGTGAATTACAGGGACTTCAAGAATCACCAGAGAGGCTGAGGTCACCTTCAGGAAGCTTAAAGGCTCTCCAAATAAATCCACCATGGAT
ATTTGCGAGGGACTACCGTGAGGTTGGTTTTCCGGACTGGGGGAATCAACGCTGATCGGTGGAGATATCGGAGCAAGCGGTGATTTCTTGGAATGCGATG
CAGTTCCACGTCGGGCAGCAGAACGGGACGAAGATAATGCCGCCAGCAGAGAATCATCGTTATCAGCAGCAGAAGAATCAACTTGATCGCTGCCCTCCGA
TCGCTCTGGCGATGGAGATCGAGAACCAAACGGATCAGGAGAAGCCTATCGACCCGGCGACAATCTGGTACGACGGACACGCTTGGTTTTCGGTTTCCCG
GACTTGGAGTTAGGGGGCGATCGCTGTGTCGAAGCGAGGAATTTTTCTGGGAAGGCGCGGCAGGCGCAGGCAGAGCACTTGTAGAGGCACTAGAGACTAC
TTCAGCCATGCGAGTGAAGAGCGAATATTTCGACTGGAGTGCCTGATCGCGCTCTCCTTGAACTCGCCAATTTTCTTCACTAACCTACCACGATCGGCAT
CTCGATTGGCGAGATCCAAGTTTAGCCGATCGCGCTGAGTCGTGAGATCTGAAATTTGAGCTGCGAAGCGATCGCGCTCAGTCTTGATTGTACCCAAGTT
TCGCTGGGCCATGGCTAACTCCCGCATGATCGCGAACTGGCGGGGCGCAAATCAGGTTTTCNNNNNNNNNNGAAGGAAATCGGGTGTATGGTTTGATCAT
AAAGGTCCTAAGGTTGTTGATCGTAACATTGGTCAATCTTGGTCGACGTGATCAACTGGGATGACCAGAACTACTCCGGAGGAGGGCGAGCTTTGCCCAG
TTGAACCGGGAAGATGTATACCTTGGGCTTTGAAAAGTGATGATAGAACAAGTCTAGATCAATCTCGGATACGCTGATCAGGCTCACTCTCCGAGCGGAC
CAAGGGGACACATCTACTGCCGATCGCGGAACACAATCGCGATACCCCGGAATCCAACGATTGCGGGGTATGTGGGTGTCAGGAAGTGCCGAAAATTCCT
CAGGAGTCAGCAGTCAATTACAGGGAATCCGAGAATCACCAGAGAGGCTGACGTCACCTTCAGAGTCGCTTGAAGGCTCTCCAAATAAATCCACCATGGA
TATTCGCGAGGGACTACCGTGTGGTCGGTGTTCCGGACTGGGGGAATCAACGCTGATCAGTGGGGAATTCGGAACAGGCGATGATTTCTTGGAAGGCGAT
ACAGTTCCACGTCGGACGGCAGAACGAGAAGACGATAATGCCGCCAGCAGGGAATCATCGGTATCAGTAGCAAACCAAATAGATCGCTGCCCTCCGATTG
CTCTGGCGATGGAGATCGAGAGCCAAACGGATCAAGAGAAGCTGATCGATCCGGCGACGATCTGGTAAGACGGACGCGCTTGGTTTTCGGTTTCTCGGAC
TTGGAGTTAGGGGGCTATTGCTTGTGTCGACGCGGGGTATTTTTCCGGGGAGGCGCGGCAGGCGCAGGCAGAGCACTTGGAGAGGCACTGGAGACTACTT
CAGCCATGCGAGTGAAGAGCGAATATTTCGACTGGAGTCCTGATCGCGCTCTACCTTCAACTCGCCTAATTTCTTCACTAACCGACCACGATTGGCATCT
CGATCGGCGAGATCCAAGTTTAGCCGACCACGCTGAGTCGTGAGATCTGAAATCTGAGCTACGAAGCTATCGCGCTCAATCTTGATTATACCCAAGTTTC
GCTGGGCCATGACTAACTCCCGCATGATCGCGGACTGGCGGGCGGCAAATCGGGCTTTCGCGTCTTCGATCTGGATTTTTGCCTGATCATCGGCATCCTT
GGAAGACGCAATCGCTGGTTCCAACTCGTTTTGGATTATAGCCAGTTGACGCCGATGTTTCTCTTGTTCGACATGACGGGCCGCTTTAAGCTTCAGGAAG
GAAGATTTCAGGATTGGAATCTCTTGTAGACGTTTCTCTTGACCAGCCAATTCCTCTTGGAATTCAGCGATTTTCTGTTTGGCATCAGCCAACGAGTCAC
GCAGATTGTTGTACTGCTTGTTCACAAATTGCCGGATCAGTCCTGCGAATTCTTGAACGTCGC