Description :
From Genome Similarity Track
Location :
Scaffold_537:3396- 5315
Transcript NameFunction/comments
Phyta_totarag9107hypothetical protein PHYSODRAFT_317418
Phyta_totarag9108hypothetical protein PHYSODRAFT_515819

Sequence
1919 bases(100 bases per row)
GCGTGTTGCTgcggtggaagtggagcttGAGCAAGCGAAGAAAGAGTTACAGACGCGACAACCCCTCCCGGAGCCTAGCGAAGGGGAAACGAACGATTTG
GAGCGAGTAATGGAGAAactggcgaagaagacgcatGAGTGtgcgcagcttcgtgagGTACGAACAGAACTGAGATTTTTGTGGGGGTCGTGGTTCGTGA
AGTTAACGATGCTTGATTGTCGAATGCTCTGTATTCGGACAGGCACTCGAAAGCACAGCAACACAATACAACTCAGAGCGTGACGTGTTAGACAAGAGAC
TTGCAGCTCAATTAGTGGTACGATCTCCTATTGTTTACTACCTCCAGTGCATGAAACATGTCGAATTCTCGCCTTCTCAATTTCTGCCTGAATGTAGGTG
GCATAcgtggacagcaacaagaagggTGAAGTGCTTCAACTCATGGCGCGAATGATGGTATGCGTGCCATTCCGACGTATTTCTCATGTAGTGGCATTTC
CCCTCACAAGAGTATGATCATTGTTTCGCCAGGGCTTCACAGAGGATCAGAAACGCCGCGTTGGCTTGGGCTACCCAATTGAAGGTAATGGCGGTGGCGG
ACTCTTCTCGTCTATTATCGGGCTCGTCGCTGCAGGCGAGGGTGGAAACGCACCTGTAGACCCATCAGCGATTGAAGGCAAGAATTTTGCAGATATTTGG
TCCGAGTTCTTGCTTGATGAGGCATCCAAGGGGAAATAATATGGAGGTTCAAGTAACGAGAAGAGTTTCAAGTAACCTAGAAGTGGTTCCAAACTCATTG
TACATGGTCAGACTGCACTCTAATTCGTGATTTGTTGGATACAAAACACTTTGATTGCGGTGGAACTCTATTATCAAGACTAAAACCTTTTACTCTGTTC
TGTTTGATAAACATTGTTTACAGCAGACACTCGAACCATTTGAAGGGCTTTTGCGAGTCCTTGAAGAAACCATCGTGGGTTAGAAACGCTGTATCAGCGT
GGTTCAGCTCCGGCATGTAAAACCGATGTTCGTAGCTATCCCCGAACAAGTCAGGATCGAAGCCTCCTCCCAAGCAGCTCTGGAACTCCACGAGGCCGTC
GTTTTCAACCGATTTGTGTGGGATCAATTTACCTCCTACGATGCACGAAAGTTGATATTTTGAGAAGACGCCATCGTAGGAATTGCTACACATGGCCGCC
GTCACATTTCCGCGATAGGCTTCTTGGGCGGCCACGTATGCCGCGTTCAATTCAGGGGTGCTGTACTTTCCGTTCTGGTAGGAGAGCGACTTGCGCGAGG
CAGAAGGGGGGCATTGACCGATTAAATCTAGTATGTCTGCTGCAAAAGAGCTAATTTCATGGTCGCACAAGTCCTGGATGTAATCTCCGGCCATGCTACC
TGTCATTGGAGCGCTCAAACTCGCCCAAGACGTGCTTTCCGCAAACTTACACTTGCCTGTGGCAAGCGCACTAGCCATGACAAGCCCGCCCATCGAGTGT
GTTACGACAATGGTGTCCGAGATTGTACGCGCCGACAAGTCACTAGTTTCACTCATGGAGAGGGAGAAATCGCagaacttctgctgcagtgtgtCGTTCG
TCCATCCAGCATCGACAGTGTTCAAGACGGCGTACTTGACTGTTGAACAACATGGAGCGTGGTCGCCGATATCACCAAACTTCTCTTTCGTTAACTTGGG
TGTATCTTGCAATTCAGCCTCTTCGTTCGGGTTACCAAAGCTATGCAAGAAAATGCACGGACGAGGTGTGGACTTGCATTCGCATGAGTGAGCCTCGATT
GCCACGGGGGCAGCTGCCTTCAGTTTCCTCGATGTAGAGATTGGGATCGCATTGCCTGTTAGCAGTGCGAGTGCAGTGGGTGTCACTGGTGCAGGTGTCA
CCACAACAGCACAAGAGCC