Description :
From Genome Similarity Track
Location :
Scaffold_1300:3395- 7428
Transcript NameFunction/comments
Phypl_g13043hypothetical protein PHYSODRAFT_343388
Phypl_g13044hypothetical protein

Sequence
4033 bases(100 bases per row)
GAGTCGCTCACctttcttcgtcgctttGGGACAAGTTCCTCCAGGATGACGAGCTCCGCACTCACCTGATCTCACCAGAGCACTCGTGAGTGGCTCGAGT
CAATCTGTCGAGGTAGGATTCAGGAAGTCCTTCATCTTGCATATTTTCAGCGTAGCGTTAAACAACTCCATAATCCACTCGACATTCTGCATTTCCGTCT
CGCCCTTCAGACTCACATCACCCCAACATCGACAGTCACGTTATTGCCTCTGGACACCAGCTCGCCATCGTTCAGGTAGTAATAACCCAAGACCACCCGA
GTGTCAACCTCCCAACTTTCCAGGTAACACTTCACTCGGGGTCAATACATCGTCAATCATTTTCACTCACACCACAGTCCATCATTCTTCGAGTCCGCCA
TTCGGGCGGGCTATTGTCTAGGATGATCGTCTCCGGCCTGCATAGCCTGAAAACGAGCCTTAGCCCTCGCCCCTCGGTTGAACTCGTACAACAATGCACC
GCAGCTGAGTTGCGATACCGGAGTCCAATCAGGGTCATCGTAACCCGTCCACTTCACGAGGTAATCTTGGGTACGTTTGGACGTCCGTGTTCGTTTGACC
CATCGCAAATCCAGGATCTTCTCCACTTCGTACTCATTGTTGACATTGTCCGGTCCCAACTATCTTCGGGCGACAACGCAGTGTCGAaatcgccatcttc
gtccaGATTCAGTTCAATGGCGGGTCGGTAGCTCTCGGCTTGAGCCTGCTGACGTGTACCCAAGGATTCACACGGTATCCCGTGTCCGCAACCTTAAGTT
TCACCCGGAAGTCATCCCGAATTTTATCAATCCGGAATGGTCCATGCCAAAGGTGTGCTAACTTCCGGCTCAATCCAGGCTGTACCTTCGGGATGAACAG
CCACACCGCATCACCCTTCTCGAATCCTGACCTGAGTCGTTCCGAGAGTTCCCGCCACTTTCTGGTCTGTTCTTCCGTGCGAGCAcacttcgccttcttc
tgcaggTCTTCGGCGCACGCCTGAGCATAACTGTAATCACGCTGGAACTTGCGACGCCATACGTAAGCTGTTCGCTCAGGGAGACTGGAGGGCTTTGGTC
CTAACATGGCTGACACCCTTTCTTGGGCATCCCAACCGTGAACGAGATAGAAGGGAGTATCTAGACGGGTCGCATCGAACGACGTATTCAGGGCGACCAT
TAACCTTTCGGCATGGTCGTCCCAATCCGTCTGGTCTGCTTCCGCGATGTACGCCTTGACACTTCGCATCACGGTCTGAACTGACCGTTTTTGCTGGCCA
TTCGCCTGGGGCCAGTATGCCAGAGTGGCTCTCTGCTTACTGACCAGCAACTCTCTGAATCGCGTGAACACTTCGCTCATGAATGTAGGATCCTGATCGT
GCGTTATCATCGACGATGCTCCAAACCTCCTGAACACACTTTCTTCGTACGCTTCGGCCACATCCTGAGCAGTCGTTGAGGACATTGGCTTGCACATGAC
AAACCCAGAGAACGCATCCTGAAATAGGAGCAGAAATGTGTTCCCTCGGGCTGACTTCGGCATGTGCGTCACAAAATCCATAGAGACCGTCGTCGCGGCT
CGATGTTGCCGGGTGACGGCCCTGGATTGGGGGGTCGCCCTTTGCCACTAGCGCAGTCGACGCACTCCTTCACGAAACGTTCGACATCTGCATACATGCC
GGCCCAGTAGACCTCTGAGCGTAGCTTCTCGTGGGTCCGGGTAATGCCTTGATGTCCACCTTGGTAATCTTCGTGCGCATAATGCAACATGTCATCCCGA
AGTGAGGTCGTGACAACTAGCCTGAGCTCGTCTGTCGCATCGCGAGGGCGATCCCGAGTGGAGCGTGCAAGCCGATAGGGACGCCCCTGGCATCCAGGGC
GAACAAGTCCGCGGTCTTGGCGATCTTCCTGAGGCGCCTTGGAGAATAATCATCCAATTCACCATTCAGGAACGCTTTGATCTCCGACAAATATTCGTCC
TGTTCCTGATGTACCTTAATTCGACGCCACCTCTCGGCTTGAAACTCAAGTGGCCCCATCGGTGGGCCATCATCCGGAGTGTCCCTCGCATTGGCCCTGG
TTAGGACTGCCATCACTTCGGCTGCAGGAGAGAGAGGTGCCGTTTTTGGACCTAGGAAGGGACCTCAGGATCAGCCTTAGGCAGAGTACCGGAGTCTCCC
TCATTTTCGTCACCACTCTTCTCTTCCTGAATCACCACCGGGGACTTCACCAGTTGTTCATGGATCTTTGACACTGGTTCCAGGTGTTTCCTTTCAGCTA
CATCCTGGACCATCCAGGACTTCCCCAACGCTAGCGTTTTAGAACTCAGGTAATCCGCGGCTTGGTTGTACGCACGCTTGACATGTACCAGCCTGACGGT
CCTGAAACGGTCCTTCAGCACTTCATATTCGGCTAGTCGGCGTTGCAGATTCGGCTGATTGCAATTGATCAACCCTTGGACTTGCTGAATAGCGATCCTC
GAGTCACCAACAACCACCAGGTCCTGAATACCTCGTTCGAGAGTCATAGTCATGCCTTTCAGCATGCCGTAATACTCATCATCATTCACCGTGACTCCGT
CCAGAATATATCACCGTGCATCCAGAACCCTCACAGTATACAACCGCAACTGCCCTGTTTTTTGGAGGTCTTGGCTGCACCGTCAAAACTCAGGACAACC
CCAGAGTATTCAacctccagcatctcgatACTCACGACAGGAGGAGCTTTCACGCGCCCCTTGACCGGAATTAGAGATTGGCGACCTCATCCAGGTGTTC
TCTCGGTGTGATGCCAGCGCCTAGGATGGCTGCGAGCCCATCTTTATCTCGCTGAACCTTTCGGATCTCCAAATCGTAATGAGACAACGCAACTCCCCAA
GGTACGGTGTGTCCATCCGCAGTCTTTGACTTGATCGCCCATTTGAGAACAGAGTACCGGGTGTACACCACAAGAGGGCACCCCTCGACCAGAGTCCTGA
AGACTTGGAGCACTCGAATCACAGCGATGACTTCCTTCTCGGCGATGTGATACCAAAGTTCTGCGCCATTCAGGACGCGCCCCGTGAATCTCACCGGCTG
AATGCGACCATCATGTTCCTGCGCAAGAACAGCGCAAGCTGCCCACTGGTTAGCATGTGGTATGATCACAAACGGCTTGGTTCGATCTGGGTGTCGAAGC
ATCGGGGTGGAAGCAATCTTCCTTTTCAGGATACCGAAAGCTTCTTTCGCCCGAGTTAGGTCCCTACCGGCCCGAATTTGTTCGTCCGTCAGCTCATAGA
GGACTGCGGCAACAACAGGGAAATCCTCGATAAACTTGTGGTCGTAATTGAGGTTGCCCGAGAACGACTGGACTCCCTTCAGGGTGGATGGGAACGGTAG
CTCCTGGATCCCTTTGGCGATCTTCGGAGTAGCTCGAATTCCTTCGGCACCTATTTCATGGGACAGATACGGGATAACTCGCTTCCCGAATTCACTCTTG
GGCAAGTTCACCGAGATATTCCAGTAACGCAGCCTGAaaagcagcgcgtccagaTCATCACATAATTGCTCCCAGGTAGCTGCTCCATACGCGATATCAT
CGATGTAGGAACAACGACCTAGGACAGGACCCATTTGAGGTGGAGCTGGGATGTTACGCTTGAAGGCCGTCATTTGCTCTGTCAGCACCGATAGACGCTG
TCCCGAATGTACTTCGTCTGAACCACTCAGATGTCGTGGCTCGTAGGGATCCAATTTCAGGTAGTCCAGAACTTCTTGGTCCacaagcgcttcttcctca
gGAGGCAATCGAACAAAAACCCACAGACAGTTGTTGATCACGTTCTGGTAGATCAGCGGCGCGTTCTTCAACCCAAATGGCATTCGAACCCACTGGAAGT
GTCCGAATGGACAGACAAATGCTGAGATCATCTTGGCTCTCTCTGCCATCCGGACTGCCCAAAATCCACTGGCCATGTCTAGGCTCATGAACCACATAGC
TTTTTCGAAGCCGATCAGCAGGTCATCAATCAG