Description :
From Genome Similarity Track
Location :
scaffold_935:3395- 4766
Transcript NameFunction/comments
Pl_101819hypothetical protein PHYSODRAFT_491072

Sequence
1371 bases(100 bases per row)
CAACTCCGATTCCGACACTATGGTCCGCAAGATTGGCAAGCAAGGCGCCATGGTGCTGCTATGCAGCATCAACCTGCTCAACTACATCGACCGCGGCATC
ATCCCCGGTGCCCCCGAGAAGTTTAACCAGTTTATCACAGACACACTTGGTGTGAGTGTGCTGAACCAGTCCCTGTACTTCGGTCTGCTCACATCCGCGT
TCATCGCCAGTTACTCAATCTTCTCCATGGTCTTCGGCTACTACGCTCTCACGCACAGACCCTTCCGCATCATTGCGTTGGGTATGAGTGTCTGGGTGGT
GGCGGTGGCTATCTGTGGTATTGCCCAATCGACCGAGAGTTACTACGTGCTCATCATTGGTCGGCTGATCAGCGGTGTCGGTGAAGCTTCGTTCCAGTGT
ACAGCGACGCCCTTTATCAACCGCTACGCACCGCCTGCAAAGCGTTCGCTGTATTTGGGAATTTATTTGGCTTCGATCACGGTGGGCACGGCTGTCGGCT
ACATTTACGGATCCATTTTTGCCAGCTCCGGATTCGGGTGGGCAGGAGCCTACTACCTCGAAGGTATCATCATGGTCGGGTTCGTTATCTGTTGTCTTAC
GATTGTGCCAAATGAGTTGAATCAGATCCCCATCAAGGAGGTGGATCCTGAGGAACTCGAGTCCAAACAAGGTGACTCAGTGATGATGCCTAATACCCCT
GATGACATCGAAAAGGCTAGCGCGACCGCGTTCCTGGAAGACAAAGACCGCGTATCAGTGCGGAAGCCATCGTTCTTTATGGAGTGGTGGGCCATTTTCA
GCTGCGTACCGTTCATGTTGATCATCCTCGGACATGCCGCTTACACGTTCTCGCTGGCGGCCATGAGCACGTTCAGTCCAGCCATCTTCATCGGCCTGGG
ATTGTTCGACAGCGAGACGACTGTGTCTCTCATGTTTGGTGGACTTGTGGCTATTACTGGTACCATTGGTACGCCTTTGGGAGGAATCCTAGTCGACTCC
CTCGCGAAGAAGAAACCCGACGAGATTGGCCATCGCTGCATGATCTCCGTGAAGGCACTGTTCTACTTCATGTTGGCCGCAGTAGTGTTTGGTCTCGTGA
TGGTGGTGTTTTCCAGCACAAAGATGCTTTGCCTGGTCTTCCTCACGCTGTGCCTCTTTTTCATGTGCGCGCTGTCCGTGCCCGAGACCATTGCCGTTCT
AGAACTCTTTCCCAAGTCGCGACAGTCCATGGCCGTTGCTGCTAATACGCTGATCATTCACGCCCTGGGAGATGTACCGTCCCCTATCATTTTGGGCGCT
ATCAAGGACTCATGGGCCCCCCATTGTGGCACCGTGGAGATTGACGGTGAAGCGAAGTTGAACCCGGACTG