Description :
From Genome Similarity Track
Location :
Scaffold_14:339474- 342109
Transcript NameFunction/comments
Hyaar_Emoy2802644PREDICTED: armadillo repeat-containing protein 6
Hyaar_Emoy2802645ubiquitinconjugating enzyme E2 putative
Hyaar_Emoy2802646ubiquitin-conjugating enzyme E2, putative

Sequence
2635 bases(100 bases per row)
CGCGCAAGCAGATATTGCAAGAGACGTTCGATGAGTGCGTGGCCGAGAATGTCGCGGACTTTGACATGTCTCTCGAGCAAGCAACGGCCGATGCAGTGCA
GCAATTCGAGTCACAAGGCGTCGATCTCTCCAACATCATCAAGAACAGCGTGGAAGGGCAGGAGCCACTGTCTGGACGGCTACAGCAGCTCCTCTTGGAG
TTACGGGAGTGCTTAAACCTCAAAAAGACAGGCAAAAACGTACTGGACGTGGTCATGGATCTACAGCGCGTCTGTAATCAAGTTCCAGAGGCTCGTGTAG
TGGCGGGACGGAACGATGCTGTGGGTACGCTACTTGCTCTACTGGATACGGACTCTGATGCCGTCGTAGCGTCCTGCAGCACGTTGTTGGCGCTTTTGTG
TACCGAAAATGGGGACAATCAAGATGTTATGGGCAGTGCAGGTATGCAGAGACTGGTGTCTATTTTACAGCAGAAGTGGGAGACTGCAGAGACTGTGGTG
TGTGCTCTAGCACTGGTGAAAGCTGCGTGTGTTAAGCACGAGAGCAACAAAGCACAGTTTACCAAGACGGGTGGTGGCGAGGTACTTTGTAGCTATTTCG
ACCAAGCAAAGGGAGATGAGGTGATGTTGACGTCACTGGCGCGGTGTTTGCGTGTGCTGACTACCAACGACGATCCTTGTGCGATGTTCTCGCAAGCACA
GGATACGATTCGAGTTCTGGTTGAACGTCATGTGATCCCGTACAGTTTAGATATACTGCGTCAAGGTGAAGGGTGTGAAACAGCAAGTGGACCAACTCTG
TCACTAGATTTGCTGGTCAACTGGCTTGCAGTGCTTGCACAAGTTGCCGTGACGAAAGAAAACTGTCAACAAATTGCTGACCTGGATGGGTTGACCGCCG
TCCAGAGCGTCATGCGGACGTATGAAGACAGTGCAGTGGTAGCCAACCGTTGCATCAAACTTTTTCGAAACGTGGCGGCGGCGGACGAGTTGAAGCGTGT
GATTTTGCAATGTGGAAGCATCGAACAGACATTGCTGGTCATGCGGCGCTACGAGTCAGATGCATCGATCCAACAGAACGCGTGTGCAACGTTAGGCGCT
GTTGCACTTCGCTCGCCAGAGAATAGCCGTGTGCTCGTCGAGCTCGGAGCAATCCGGCATATCTCCCGAGCCATACAGGTCCATAACCGAGATGTAGCGG
TATTGCGCCAAGCAAGTCTAGCGGTGCGCAACATGGTGGCCCGCAATGTGGAATTACGCTCACGCTTTTTGCACGATGAACCAAAGCTGGAGCCACTGCT
TCGTGAGGCGCAACAGTATCGTGGCTGTGGGGACGAAGCATACGCAGCGCTGCGAGACCTGGGCTGCGATATTCAGCTGTCTTCTTTTGGAGTTGCCGCC
GTGGCTGCAGGATCTATCAGCGTACCTACGACCGCATTACGCTTCAACCCGGTACAGCTTCAATCCAACGAACTGCACGACAGTGTCGACGAGGTTTCGG
AGGCTTCGTTCTCTCACTAGTGATACAACAATAATGCTTCAGTGCAACTACTATACGCGGCAGCAAGCGGTCAAGGAAAAGCATCTTTGATTCAGTTCTG
TTCCCTGTTTTTGCTTGCAATTTCGACCTAGCTCGCTCCCCTCGCGGTCTTCCATTCCTCGTACATGCGTCAACCTGTCATCCTGGCTTCCTATCTCCCG
CCCACAGTCTAACGCCTGACACCAACTACAGTCACGCAATCTTTGCTTGAAATCCTGTCGACTGCATCTAGCAGGCAAGATACAAGCACGGAACGTCGCG
ACAAGACCGACAGGCACTCATCACTGCAGCTAATTCTCGTTCCATTACGTAGAAAAAGAAAACAGCCAGCAGAGCAGCGCGTTCTACTACTCCACCGTTT
GCGATCCGTCCAACGACTTGAACGCTTTATGCGATCGCCTGCCAACTCTGTTCGACAATCTCGCGCACGCGGCGATTGTACTCCCGTCGATTTTCTTGGA
AAAGCCGCGCGGCCTCCGAGTTTGCTGGCGAGTTCGGGTTCGGGTCACACAGCAGCGACTGGATGGACGTGAGGATCGCCGAGATGTCGTAGATGGGCGA
CCACTGGTTCTGCAAAATGTCCAGACAGATCTGACCGTCGTTGTAGACTGCAACACACACACAAATACCAGCAACAGCAGCACAGCAGTTGGTCAGTCAC
AATGGAACTTTGTCTCAGCAACAGTGACAGCAGGCACGTACTATTTGGATGGAACATTTTCGTGATAAATTTGACAGTTGGTGCCTTGTTCGGATAGTCT
TCACTAAACTCGAGCGTCAGATTAAACGTCCCACCTTCCCACGGTGTATCGTCCGGTCTGGTAATTTATTGTTGTACAAAAAAGAACGATAGAAAATAAA
AAATAAAACACACGAGGTTAAACAAATAAACACAAGGTTAAATCGAAAAAACACATGTAACGTCAGAGGCACGTATAATGAGTACAATAGTGGTGTCTGT
ACCCAAAAATAACGGCCTGCCAGAGCATGATATTGTTGTCCATGGGAGCGCCCGAGACGCCCGACGGTGGGTCGTTCTGCAACTTGCGAAAGTCACGCAT
TAACCGACGACGAGCAGCGGTAGACATGGTCAAGT