Description :
From Genome Similarity Track
Location :
Scaffold_126:3394- 9421
Transcript NameFunction/comments
g11913.t1hypothetical protein
g11914.t1hypothetical protein
g11915.t1hypothetical protein

Sequence
6027 bases(100 bases per row)
TCATAAGCGTCCACGAGGTCGGCGCAGTCCTCCGAGAGGCGTCTTCCAGACTCCCACGTGTTTTGATCCTCTGGATAACCGCGCCACTTCACCAGATACT
GGTAGTGACCGATACGCCCGCGGCGCTTCAGTATCCTCTCGACATGATAGTGGAGAGCGCCCTCATTACCAATCAGTGGGGGCGGGGGACGCCACGGACG
CGTCGACGGACCCGGACGCCTCGCGTCACTCGTCGGTGTCGTACACCTCGACGAAAGACGTCTCGTCGGTCCGGGGGAGCCTCCTGACTGCTGTGGAGGG
CTGCCAAAGGCTGCTGGAGATGCAACGGACGGATCTTGTGTCCCTACGCGGTCGCGTGCATCTTGTCGAGTCGACTGTTGAGTCAAGACGGGACGTCCCT
CACGATTTAGGTCGTCTCGAGCGCGGAGCGCATGATCTGCAACAGCGGGTTGATGGCCTCGAGCAGGAGCTTCGTCAGGTCGCTCACCGCTGCTCGGAGA
GCGAACGAGCCCTTCAGGAGGACCGCGGTGCCCTTCGGGATCATCTTCACTGGATCCGACAGCTCTATGCCCGCGTGGGCGCACTGGAGGATCAGACCCC
TCAGAGGGCCGCTGCTCCGCCGGCTGTTCCAGCCCCACCCCAAGCTGACTTGATGCAGATGATGGCGAGCGTCCTTCGGCAGTATTCGAACTCGTCGGAC
TCTCAGAGTCGTCTGCCTCAGCCGGGCGATAAGGCTTGAGCAAGCCCACGTAGAACGTTGGATGCGTGGCCATGGCCGATGGCAGGTCCAGCGTGTACGC
GTTGCCGTGGACCCCAATGACCGTGAACGGCCCCACGAATCGTGGCCGAAGCTTGGTGCTGCCCACCGCAGTGACTGCCTGGATAGGGATATTCTTAGCG
TTTAAGAGGACCTGGTCCCCAAATTTAAACACGTGCGTGTTCTTACGCCCTTGCCTGTCACTATGTTCCTTTTGCGTGTCTTGAGCAGCCGCCATAGCGT
CCCGGACGCGCTGTCGTACTGCTTCACTTGTCTCGATGAACGTGAGGAGGTTCCGTTTGACGGACGAACGGAGGCCTTGAAGGCCACGCGAATCTTCGGC
GATAGCCTCTCCCCCACCCAAACTCGAAGCCGGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACGTAAAATGGGGTGAAACCTGTCGAC
GAATGCACAGCATTATTCAGCGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGGTCTTCAGTGCAGATGCTGCGCAGTACGTCTTCCAACA
CTCGGTTCACGCACTCCGTCTGACCATCGGTCTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGACGGAACAAGTGTGTCCAAAAGTG
TGACACAAAGCGCGGATCTCGATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACAATATCGACGAAGAGCTGTGCCGCTTGCGGCGCCGTC
ACGCTCTTCTTCACCGCGACAAGCCGCACCATCTTGCTCAAACGGCAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAGA
TGAAATCCATGCTCACCGAGCGCCAACAGTCAGCCGGCACCGACAAGCTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGGCACGTCTC
ACACGTCTGCACGTACGTGCGCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACAGACGTATACGTCTTCTCTCGGCCAAGATGACCGCTG
AGCGGCGTGTCGTGTGCCTCGTAGAGGACTCGATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCTACCTGTTAGTAGA
GGAGACCGTCCGCTAGTGAGTAGCGGTGCAACCGTGAGCGCTGCCGAGCTGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGGC
GAGATCGCCATCCTCTGCGTACGCCTCGCGTAGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGGCGCCGGGACAAC
GCGTCCGCGAGGACGTTCTGCTTCCCTGGTTTGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGGGAGAGGTGGG
GCGACGACGTCGCTGTCCGCAAAGACGCATGATCTGTGTAGATCACGAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCAT
CGCCAGAAGCTCCTTGTCATGGACAGGGTAGTTCTTTTCAGCCGCCTTAAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACC
TGCAGAAGGGCACAGCCTATGGCAAAGTCGGATGCGTCGCATACCACACTGAAAGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGC
TGCTTTTGATTGCCTCGAAAGCCCGCTGGGCTTCATCGTTCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTA
GTTGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCTGGGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTC
TCAGGGTCCGCACGGACACCATCCTTGCCAAGGAAACATCCCAAGAAGGGAATCTCCTCGGTTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGAT
TCTCGCGCATGCACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTGTCTCCTGAGGCACGACTGTGCACGAAGATATCATCAAA
GTACGTCTGTACGAACTGCCCCATCGGCCGGAAGAGTTGAGTCACCAATCGATTGAACGTGGCTGGTGCGTTCGACAACCCTTGGGGCATCACGAGCCAT
TCCCACAGCATCCCGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCACCAGCAGCTGACAGTAGCCATCGACCATGTCGAGTGCACTGA
AGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTAC
CATACGCCACTTCCCATTGGGTTTACGCACGCAAAACGTCGGAGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAG
AATGCGTCGATCACATCGACTTGCTCCTTCGGTAGTGGTCATTGGCGCGTGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTC
GATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACCACATCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCGACGGGTCTTTCAAAATGGCCGC
GCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCTTCCAACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGATCGAATCGAATTCGCGTCGG
ATCAGGACCATCTCCTCGAGCACGCCCGCCTTCAGAGAGTCGAGAAACTCGACATACGAGAGCTCTTCGAGTTCCAGTAGCTCTGCTACCGCGGGCAGAA
CAGCTAACTTCCCGCCGTCCTTGTATTCGCCCGTGAGCATGTCCAATACCGTTGGTCCGACCACCCTCTCCGAGGGGTCTGCAATGCGGCGTACTACGCC
TGGACGTAGTCCCGCTGTAGTTGTGCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCA
CTCTCGGTTGCGCGAGCCCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGGACGCCTTGTATGCCGCCCGCCCCGTGGGCAAAGGCGACGT
TCTCGTTCTTGAGAGTTCCATGAGCCTCATCCTGAGGAGCGCACAAAAATCCCATAGCTTCTCCCACACCCACCGAAGGCACATAAGCTCTCGAGGATGT
AGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTACCGTTCGCCGCGTGGCACAGCACAAACCCGTCTCAGGAAG
AGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGGCTTGTGACTAGCACCGATGGTGCGACTTCGCCAATCAATCCATGGCTCATGTTTAGTAAG
CCAAGGCATGCCTAGGATAAGATCGTATCGATCGTCCATGTCGAGGACAATGAACGGTTCGACCGAATTGAAGTCGTCAAACTTGACGTTTAGAGATAGT
AGAACCTTCCGTGTAGACACGATGGATCCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTAGCATACAATGCACTGT
TCCTAGCCACACTGGACTTCGTCACGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTAACGCTGGCTGTGACAAC
AACGAGGTTGGACCGCGCGGCGGCCACGGAGAGACACAGAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCAGAGCTACCGACCTCGAG
GAGGAGCGATGTCTCCCAGCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGTGACGGAGCGGCCTTGCC
GCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGCGTTGATTGCGCTGGGGA
CGAGCCGACTCGGCCGACGAGATCTCCATAGGAGTGGGATCTTCCGTCGCCTCTGTGCGACCCGCGTAACCCTGCGCCGAGCGCACGCAATGATCTTCCA
GCATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGGCCCGGACGGACGCCATCCATGAAGACCGTCAC
CTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCTTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGCGTGCGCTTTCCTTGCTTGCACCGC
AAAAAGAGTGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAAATACCCCGGAGACG
AAGTCTCTCGTGCCATCGCCCATGCGCGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACTCGTAGATCTGCCCAGCGCTCAG
CGCTATCTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTGCCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCCTTGCCGT
GCGGCGTATGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGTGCGAGCAGCTTCCTGTGCTGCAGTACTCACGT
GAGCAATCAGCGACGATTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGGAGGTTGGGGAATCCAGCAAACGCTGCTTCGCCCAG
GAGACTGACCATCTTTTCTAGCGTAGCCCAGTGGGCATCTGAAAGATGAGGAAAATCCTGCCGGGACGGCAGCCTGCTCTCTGAGTCTTCCATCCTCAGA
GAGATCTTGATTGTAGCGATCCGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCACCTTAGCCTTAGAGGAAGCGTT
AACGCGCTAACCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGAGTACCAAACGACTTGCGAACTTCCAGGTT
AGAGTTAAACTGTCTGTATTAATCTCA