Description :
From Genome Similarity Track
Location :
Scaffold_558:3394- 4421
Sequence
1027 bases(100 bases per row)
CAAAGATGAAACAAATCAAGTCCCGAGTGAATCTGCGTCAGTGCGCTAGTTCGGAGCTTATGAAAGCTCTCGACAAGCTCATCATGTCATGTACTCATCC
AATATGTGTGTGTGTGTATCCAGCAGTGCGCTATGATCGTGCGCGTGACAGTCAGCCATGTTGACGCAGCCAACTGCATAGCAGACATCAACATTAAAAA
CAGAGACAATTTCATTTTCTTTTTACCTCTCAGTGATAGCTGGAAATTGCTCGATAATATCGACAAAGCGGTCAGCAATATGACGATGCTAAATTTTGGC
AATCGGGGATTTAAACGAGCTGATATTACCACGTCTAGAGGCTGTTGCTGAATCTTCACGTGTAATAGCGACTCATCCATCCGCTGCGATGAGACGTTGC
CGACGAGAAGGAGGATGTGTTGACCAGCAACACGCATCTGCTAGTTCAACTGCGACAGCCAGCGAAGAATGAGCGTTGACGTCATCCATTCTTATTTTGT
GCGTTTGTATTGCAATCCTGGATATTCGGCGGAGTTTCCCTCAAAGCAGCGAGGTTTTTTTCATGGATCCAACGAAGAGAAGTGGAAGCTTTGAAGTTCC
GTGTATATTGCAACATTAAGTGACCGCTAGCCTCTTTTTCTGGTGCTTTCTTCTTGCGATACGATCTTTCGTGATAGACTTGACTGGCAAGGAACAATAG
AAGAAAGCTTTCTCATCCATATTAAGCATGTCCCGCTCGTCAATAGCCCAGTGAGATTTCTTCCAGTGCTATCCTTCCACTCTACACCACATTAACATTC
ACAGATGCCGCCTCCCCATGCAAACGCTTCGACGTCAGACCGTGACCGAAATATCAAGATCAGAATAGGAACATGCGATGGCGGGATTCTTTGGAGGAAT
AGTCAGCTGGCTTTTGAAACAAACGTTAGCGCCTCTGTCCACCTCATGCTGGACTTGTTACTACTGTACAATCTCTCCTCAAACGAATCGGAAATGGAAT
TCATCCAACGAATTTGACATAGCGTAG