Description :
From Genome Similarity Track
Location :
Scaffold_12:339279- 342116
Transcript NameFunction/comments
Physo_130669reverse transcriptase

Sequence
2837 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCAGGTCCATACACATTTAGGATTCCTATCGGCTGAAAGCAGCATCTTT
TAGCCAATGAGCGACATGTATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATCTAGAGTAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTTGTGGATCTCGAGTATACTTAACTCAAGTA
AAAGAAACCTACGATTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGGACTACCTGAACGTTCGTGCGGAGCTGTACGAACGATGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAGCTCCACTTCGCCA
GCAACTCATATTGCCCGCGCTAACTGCCTCCACCTGTCAGATCCAGAGTGAGAGGCACTCCAACGACTGCAACAGTCATTGGAGAAGCGGCTGTAGCTGT
AATGCTGCGAACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTACCACGGTGGCGTCG
GAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTG
CCATCGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGACT
CTCTGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCACCCCCGCAAAATGAGTTTCGGTCAAGGGCAGAGTTCCTCGACCTAC
AGCAGGGTAAGCATGATGTCCATGCTTACGCGCAGAGAGCACGGTACTTGGTCTCGAACATTGTGATCAACCCGATAGACGAGGCGACCAAGGTCGTCAC
ATTCATGAAGGGTCTGAGAGATGGGTCTGTAAAGACCTATCTCTTCCGTGAGTACCCAGGTACTCTCGAAGCTGCGATTACTCTTGCAATACAGGAGGAG
TTTAGTCTGAGGCAGGCTAAACTACATGCGAATGCACCGAGGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCGGAACCAATGGACCTCTCGAATG
CAACGGCTGTTGGTTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAGAGTGCACGGCACCCGTGCA
CCGAGATGGTGGTCGACGCTGCGATGCCGGGCATCGTCGCGGACAAACAAAAAACGCTGGAACCCAGTAGGCGCGGGGCGCGCCCTAGTTCCGTGTGTTG
ACCTTGTACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAAGCAAGATGACAGGCCTGACCTTGTCATCCTGAATGTGAA
CTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTTTGGCGCGTCGAAGAACTTTGTTTGACTGCGACGTCTATCAAGGCTTGACTTCGAGGAT
TTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACAGAGACGCGCATGGTACGTGTGCGCTTCACGTATGAAGATC
AAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCGATTG
GGAGAAGCGCACTCTCGCGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCA
CTCGAGACAGCGCTTAATGCTGCTGTCCCGGAGCGCCCTGGGCTCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGGCGCCGACTGCTAATG
AAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGC
CTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGGCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATAGCTTG
GGTGAATTTGATTTGTCGGCTCGGGGAGCCGACGCATCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGCTGATGATGGCGTGTCGGCTCCGG
GTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACCCTCGCTAACCCTCCGACACAAGCATCGGAGTTGACTTCGCTTCCAGTCATGAGCT
GGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGGCGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCA
GTTCTTTATGGAGACCACCACTGAGAGTGAGGCCACTCTCAGTGCGAAGACTAAGAAGGAGCGCTATGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGT
CCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCTGGAGGAGATCCCTGCGGAGCTTCCGCAGGATAAGGGCATCCAGCACAAGATTGATCTCG
TGCCGGGGACGAAGTACTGTGTCAAGCGGCAGTGGCC