Description :
From Genome Similarity Track
Location :
Scaffold_33:339143- 340498
Transcript NameFunction/comments
Phyci_221860hypothetical protein PITG_02714
Phyci_574190conserved hypothetical protein

Sequence
1355 bases(100 bases per row)
ATTATCTTCCACCGTGGCATCTCAGGGGAAGGATTGCTAAATCAATAGCATACTAGTTAGTACTGGATTTGCAACAAGTGGCATAAGAGAAAATGTTACC
TGTCGTAGCTAAGGCTCGGACGTCGAGTCAATTTGGATTTACTCTTCTCCATCGCATTGGGTACGAGTGCCATCAAACGTTCTTGAGGACTTTTTGGTGG
AGAAATGGCTGCAGCGGCCTTATCATTCACAGCGTCGGCCCCATCTTCGACGGCTTCTATTGGTGTGGGATTGTATTCCTGTCGGTGAGCGAGACTGTTT
TCTGCAGTCACGCGGTCCATTCTGGCCAGCGTTTCCTGGCAGATCTCTCGAACGCACACCAACTCGTCCTCATCGTCTGCAGTCTCGTCGAGGATGGTGT
TAATCCCGCTTCGAAGTGCCGCCTCGAGCAGCATTTCTACCGGCGGCGTTATGGTTGACTCCGATGTTTGGTTGACTGCATCTGTCTCTAGAGCCCTGAC
GTCTGGAGACCCAAAGGTGTTACTAGTCATGTCCATCTCCAAGCCCAGCCCAGGGGGCTGGCTACCGCTCAACACGTCCGCCATTCTGTCTACTCCGAGC
TCCCCTGCCCCCGTCCAGATCGCTCAAAACTCAGGCTAGCAAACCACCTCGCCCTCCCCGCCTGCTATATATACCGGCGCTCGTCTCGTAGGCGCAATCG
CGTTCCGTTTCACAGTTCAGGAACGTCGAGGCCAGATTGCCTGGGTTGGAGCTTAGGCAAGCCCTTGCCCAGCTTTCTAAACCAATACAACGAATTATGA
GATCAAGCCCTCATTGAGGAGGCGTTGGGCATCCTACTCAGCTCACGTAGCTGCGAACAATTTTCCTTGCTATTGTCTAGAACAACCTCAGTGTTCTGCA
TATACTTAGTATTAGGTAGTGTCTTAGTATGTCTACACTTGCACTGCGATGCTAGGTAAGTCGTAAAATGTGGAATCGAATGCAACCGCAGCAACTTCAA
CTTCTGCACTGGAGTGATGGTCTGGGAAGTTGAAGTTGTGTTACTCGAAGGTTGCAACAGCCCGCGCCTTTCGCTCTAATGGAGGAAGGTGGCGTGTCCG
CAGCTGGAGGTGATGCCGATAGCCGTGCGAGAGAGCTGCGGCGCCGTGTGGCCAATCGTCGCCACACTGGTGCTGCCATCTTGAACTCGTTGCCGCTCGC
GCAGCCGCTCAGTCTCCCGCAACTTTTCTACGCAAAGCACGAGGCGCACGAGATCCGAATGCAACTGATCGACATGCAGTCGCTGCATAACACGGCATTA
ACGTACTGCGACCAGCAATTCGTCGTAGAGAAGAATGTCCGGTAAAACAGAGACT