Description :
From Genome Similarity Track
Location :
Scaffold_28:33913- 42758
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_28-fgenesh-gene-0.2TPR repeat-containing protein
Pytar_ATCC12531fgenesh_masked-par_contig_28-abinit-gene-0.50Ferredoxin
Pytar_ATCC12531maker-par_contig_28-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
8845 bases(100 bases per row)
ACCATGGCGCCTCGCTCGGCGCAGACGCCCGTGCGGCTCAACGTCTACGACCTTAGCGAGGCCAACAACTACATGTCATGTACGCTAGTGTACCCCCTGT
CGCTCATGCACGGAAATGCCTCTCATCACTGGACTGTGGACGCAGACATCGGCCTCGGCTTCTTCCACACGGGCGTCGAGATTGCCGGCGACGAGTTCTC
CTTTGCGAGCGGCGCTGGCGTCTTCTCGTCAACGCCGCGCGATGCGCCAGGTGCGTTCAATAGAATTGGGCTAGGATCTCGAACGTCTGACTGACTACGG
TATATGCTGTATACTGCCTGGGATTCCAGGCGCGCGCTTCCGCGAGTCGATCGACATGGGCGTGTTTCCCGGTTCGGCCAGCGAAGCTCGCAGCCTCGCG
CTGTCGCTGCGCCCCGATTTTGATGGCGCTACCTACAATCTGCTCACCAAGTGCGTACCTGCCCATGGAGGATTCGAGTCTCTGGACAAGAATCCGTCGC
CTGACTGCGGATCCCGGACCGTTTTCTGTAGAAACTGCAACGCGTACTCCGACGCACTCTGCCGCTTGCTGCTCAACAAGCCGATTCCGCCGCACGTCAA
CCGTGCTGCGTATCTCGGGTCGTTTTTTAGCTGCTTGTTACCTGAAGATCTCTCGGGCCAGGCACCCGTGGGCGACACGGGCGGAGGCGCAGCAGCGAGT
AATCGCCGTGTCGAGTACTCGGCTTTTGCTGGTCCGTACGATCTCAGTATCCTCCTCGATCTCCTAGTGTTCTTATTCTATGAAATGTACTCCTGCAGGC
GAGGGCATGGCACTCGGTGCCAAGACCCAGACATCGTCGTCGTCGACATCGACGCTGGCCGACCGTCGGGAGAGAGTGCGACTCGCAGCGTTGCAGCGGA
TGCAAAAGCCCGACAATGCAGCCTCGTGATTCCCCACAGACACAAGAAAGAGAGGGAGAGAGACAGAGGAGAGAGAGAGAGACAGAGAGAGGGTCCTCAA
AACCTCTTTCTTCAATGTGCATGTCTTTTTCAGCGTGCCAACTAACTTCCGTTTCGACACGATTTATTTTTACGGCTTGAGGAGACCAGGTATGCATATT
TTCCCTCTTGGTCACCCGCTTGAGTTTATTCCCCCTGTGTAGGAAAGAAGATGGGAAAGGCGGCGGCATCGCCGTCCAAGCGAGCCACTCATGGAGGAAC
GACAGGCTCCGGCAGCTCCAGTGGCATGGTGACCGTTGGCGGATCCACGACCCCTAACACTGAAGACCTCTTGCTGACGGAACGACCGGAGCGTGTCGAG
AGCACGGTCGTGTCTCGCGAGAACGCGACACACTTGGCGTTTGCTGCGAGCCGCACACTGGCATTCCCCTTCGCGGCCTCCAGCCAGTACATCCGTTTGC
TCCACGACCACTGCAACAGCTCGGATGATCCGAGCGGGTCGTCGTCGGCGCTGCTCGTGGTCGTGGGGCCGCCTGGCACGGGCAAGTCGGCGCTGCTCTC
GCATTGGGCGGCACTGCGACGCACCGGTGGCGAAGACAACGGCACCCATGAATTTATCTATGAACACTACTGCGGATGCTCGTTTGACAGCGTCAAGCTC
TCGCTGTTTCTCTTTCGGCTTATGCATCAGCTCAAGACCACGTTTGCTCTGCGGGACTTTGAACTGCCCCACGAACACGAGGAAGAGAAGCTCAAGTTCT
CCCTTGTGCGGTGTCTTGAGGCTGCTGTGGGGCGCACGACTTCAACTAGCCGCACAGGCTCGGGCCCCTCGACCAAGCGGAGAAAGTAAGTGAGGTGATC
ATCTCCCTTGGTGCGGAGCGAGCTTACTGATGACTATTTCTTGTATCCTCCTCAGCATCGTGCTCATTCTCGATGGCATCGATTGCATCCGCACTGAGGA
CGGTGGCGACTCACTGTCATGGTTGCCCAACACCTTCCCACTGGGCGTGCGTATTATTGTGTCGGCCACGCATTCCGGCAGTGGAAAGAGTAATCTCGCG
AGTGCACAGAGCGTCATCCGCAAGCCCGTCGTGTACGACAGCGACGGAGATCTCATCTACGACACGTCCCTGCCACCAAGCGCCCACGACTCGCACACAA
TCCGTGAACTGCGGCGGCGTCGCCACGTGAACTTTGTCGTGGTCGAGCCGCTTGATGAGATCTCATGTCGAGGCATCCTGGAGCTCTACAACCGTGCGGC
TACAGTCCAGTCACCACTGACTCTGGAAGAGCAGGACGCTGTCGTCGCTGCGCCGGGCAGTGCCAACCCACTGTACCTGCGACTTTTGCTGCAGGGTCAA
GAGCTCTTTGAGACGGGTAGTCCGGATCGGGCGGCGTGGCTCGAACGAGCGACCAGTGCCAGCGAGATTAACGGCGTCTATGAGCTGCTTATTCGACGGT
GGAACGATATTTTGGTGGAAGATCTGAACGAGCAGCTCCACAAGCTTACGAGCGGCTCACCAAGCGAGATCGCCGAGACGGCGAGTGGTGAGCATAAGAT
TGTGCGGCGCTCAACCAAGCGAGACATGACTGATACCACTACCACCACCACCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTCAGTCGGTCCA
CAGTGGTCCGCTCCCGCTAACACGGGGACCGTCAGTTCGGGCAGTTCATCATATGGCCTCGCCATTCCCCGATCCCGTCGAGTTGGAGAATCTCCACATC
GCCATGGAGCAGCGTGTGCTGCTCGTGCGTCACACGCTGTCGCTGCTGGCCGTCGCGCGGTACGGCCTGTCGGAGACCGACTTGCAGCGGTTGCTCGGAG
ACGCCGTGCCGCGCGCAATCTCCCAGCGGCTGCTCGGGCTCTTGTCTCCTCATCTCATGCAGATCCACCGCCACGACTGCGGCGACAACCGCGTCGTGCT
GCTCGACCTCAGCCACAACCACCTGCGGCTGCTCGTACGGTACGGCTATCTGAGAGACGACCACTTGCGCACATGCTATTACAAAGAACTAGCAAACTAC
TTTGGCGGCCTCGAGGCCTCGCAGCGGCGCATTGATGAGCTGCCTGTGCAGCTCGAGCGGTGTGCCATGTGGACGTCACTTCAGGCCGCGCTCGTGGACA
TCAAGATGTTTCAGCTCTGGTGGAGCGAGCGCAACCGCGAGGCGCTCTTCGCGTATTGGCGCGTCCTCCGGGCCAACTGCTCGCTTCACGATCCCGTGGA
CGATTTCGTGCGGTCGCTCGACGAGTTTATCGCGCACGAAACACCCAGCGCCGATCAGCTGCTGGCGCTGTGCCTCACAATTACGGCATTTCTGAGGGCG
TGGCAACGGCTCGACGACGGTGGGCGCATTCGGCAGATCGCACTCGCGCGGCCGGCGCCGCCGCAACTTGGAGCATTCATTGTGAGTCTTGGCAGTCAAT
TTTCAATGGTCCATCTGGCTGAGCACGACGCCGTCCGTGTGCAGCATGAGATCGACGCGCTTTGTCTCCAGGGAGATGATGCCTACTTCGTGCGGCGCTG
GCTCTGGACGCAGTTTCCATTGATCGCCGTCGCGTTCGAGTCGCGATTCCTGCGGAGTCTGCTCGCCGGCAAGGCGTCGTCTTCCGTGACGGTGCTCGAT
GCAGCGGTCGCCAGGGATGAGGACAGCGTCAGTAGCAGTGGTAGCCACGCGGAAGGCGAAGGATCCGTGAAAGGCGCCCTCCAGGCATCAGGCAGCGGCA
GCTCGTCGAGCAAGAAGGCGTTGGTCGTGCTGCCCAAGAGCCTTACAGCAGGGAAGACTCAGAGTCCACTCAAGCCGGCGAAGCGCAAGCCGTCGCTGCT
CTTTGCTACTGGCACTAACAATGCTGGCGATTCGATCGAAGATGACGGTGCGTTCGAGTTTGTGTCGACGGAGAACACTGAGCTCACGGTCGGCTCGGTT
GCGAAGTACGAGAACCAGGTCATGGAGCTGCGCATGAAGTACGACAAGCTCAAGTTTATCTCCAAGGCGAAACGGGACGCACTGAAGGCGCTGGCGTCGC
GTCTGCTGGACGTCAGGGCGCAGGCGCGGGCGGCCGGACAGAGTGCGAGCCAAGTCGAAGAGTTGCTCAACCAAATCCGTGCGATTGGCGATGAGACGCT
CGTGGGCCGCCAACGTGGCGACTATTACAAGGCTATTCTGAGACACTGCGAGATTCACCCGGCGCGGGACGCCAATGCGATTGATGTGACTGAGACCGCG
GTCCACAAGATGAAGCACGAGATGCTCGAGCTCCAGCAAAAGACGCAGGTGCTGGCGTACGAGGCCCGGCTCGCAAGCGGCGAGAGCAAAAAACTCCACC
AGGTAATCCGTGACAAGTCTCAGATCCACACGACGGCCCTCGAGCGGCTCCGCTGGCGGTTTGAATTGCTCCAGCGCATGATGCTGCAACAGCGCAAGGC
CGTCACTGGCGGTGGAGGGACAGCAGCGGCGACCAAGCGGATGCTGCGTACAAGGGGGGATGACGACGGTGAGGAAGACGAGGAGGAAGACGAGGAGCAC
GACGCGGAAGAAGAGGACGCCGAAGAGGATAACAATGGACGCCCACGATTGTCTCGGAAAAAGTCGCTGATGGATGATGAGCAGACGACACAGTTCAACC
GCGCTAAGGATAAGCTGCTCCACAAAAAAGAGACGACGCTCGAGCGGCTCCGCAAGNNNNNNNNNNGCGAGTCGCTCAAAGTGTACGTGGGCGGTCCGTT
TCGAGACGATGGCGTCTTAGGCGCGCTGCGGCAAGTGGGCATCAACAAGCCCGAGGAGGCGCAGCTCTACTGGCAGGACCAGCAGCACCACGCGGCGCAG
CTCGAAGCGGAGGAGAAGAGTTTGGAGCAGCGCGTGGGTGATGCGCGCGACCGGCTCGCGAGTCTGCAGGCGCAGCTGCTCAACCTGAAGCTCGGCGGGG
GTAGAAGCAGCCGAGATGCTGGCGGAGGAGTAGAATTTATCAGTGGCGCCAATTCTTGTGCTGGAGCCACGACGGCGTCTGGTAGTACCCCCTCCTCTGC
CGTGATCACGAGCGGAGCTGAGACGACGACCACAACTGGAGGTGGAAGTGGAGGAGGAGCGTCGTCCCATAATCTCAAGCAACTCGAGCAGCAGCTTAGT
GATGCGCTGGCCATCACGCAGCAAAAGAAAGAACGAGCGGCTCGAGCCCGGGCCCTGTCAGAGGTGAGTCGTGTTGGCCTCTATAGTGTTGTAGCTCGTG
GTCTTTTGACGAGGAGCTTCTTGCATGTTCAGCGGCTTCACCTCGGTCTCCAGCACGTCGCGCAACTCTTGGGCGTGACGACGACGCAGCAAATGGAGTC
AATCGAACTCGCCGACGCCGTGGAGCAGGTTGTGCGTCTGTACCTGGGGGACGAAGGCCACTCGCAGTCGACCGCAGCCACGAACATTAGGCGGAAGAAT
AGCGTGCGGGCCATGGGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGGCGCCATGGCGTCGCCCGACGCGCGCTCACCCGACGAGAAGC
GCCGCTTCAATCTGAGGGTCTCCAGGTCGCTACAGCGCCAGATGAATCCGTACGTTGACGGCGATGCTTTCGGAGGACCAGCAGACGACAGTGACGAGGA
TGAGGATGACGACGGAGACGAGGACGACGCGCCGTCACCACGGCGCACGAACCAGCCTCAAGATGTGTCGACCGAGCCCGTGACGCGCCGTGCCGACATC
AAGAACCGTGCGCGGCTGGAAGTGGAGCGCAAGCAGCGTGTGGCCACAGTTTCCAAGGCGTCGCGCGACAAGCATACGAGCACAAAGGCGACGACCAAGC
CCCGGAAGGGACCATAAAGAAAGAGGAAGAGAGAGAATCGACTTCTCTTTGTTTGTTTTGATATGAGTGAGGGTCTGGGTAAGTCTCTCTTCTCCTCTTC
CTGTCTCCCGCGCCGACTCGTTACTCGACGTCGTCCTCTTCGTCGTCGTCGTCAAACTCATGCACATACTGATACGTCTCGACAGGCGGCGCCTCGGGCA
CAGCGACAACGAGTCCGTCGAGGTCTTTCGTCAGCACGATCTCCGTGCCGAGACGCGAGCTGTGGTCATCAAGAGTGTTGGCGTCAGTGCGGAAGAGAGC
GAGATCTCATAGGATCGGATAACGCACTTGGCCGAGCGGTCCGAGTCAGGGACGTAGCGGAGCACGTGGAGCTCCTGCGGGTTGGGCGACGGGATCTTGT
CGACCCACTCGTTCGAGATGATGACGTGTGACTGCGGCGACACGGAGCCTTCGCCAAAGAGGCTCTCGGTGTAATAGTCGGCCCGCACGGCGCTGTGGGT
GCCGCCGCCGCCGTTTGAGTCGTCCTTGACGAGCGGCACGTGGTTCATCTCGCACGCCTGGCGCAGCGTCTGGCCCACGCGGCCCTGCACAAAGTGGCGG
TTGCCTTCAAAGTCCACGAGCACGACATTCACGCTAGAGAGAGCAAGCCAACGGTCAGTCTCCATCCTCCATTCTCTCAAGAGCTCCACGCCACGCACAT
CTTCTCCGAGACCGTGGGCGCCGCGTCCGTCGCGCCCGCGAAGCCGCCGATGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCGCCGCGCTCGCTCGCACTGCTCTCGCCAGCATGGTCCCTTTCCGAGTGATGATGCTGATCCCGAGGTTCTCCTTTC
CAGGAGCTCCCTGTGCGGTCCGCCACACACGACTGCAGTAGAGAACCGGTATTATTACCGGTTTCTAGGGTGCAAACATATCCTTTGAAATCGGATACAT
GTATATGGTGTTGGAGGTACGTCGAACAACATCTTCGGCGTCTGAACAGCTCCAGACAGGGGAACACCATGGCGGCCATGTACACCAAGATGACGGCCAC
GGGCTCGTCGCTGATCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGATCGCGGCGGCCATCAGCGGCGTCGTGGCC
AAGCACGACCTCAGCAAGCTCACGACCAAGCTCGTGCGCCAGTACGTCGAGAAGGAGGTGCACGTGAGTCTGACCAACCACAAGGAAGTGCTCAAGCGGC
TCATGCACAGCGAGTTCCGCCGCATCAAGGCCGAGAAGGTGCGTGCGCAGTCGCAGCAGTGGTGGTGGGGAGCTGACCCGTTCTCTCTGTGTCGTAGGCG
GCCAAGAGGCCCGTGCCGCAGCCCTGGAAGATCGTCCTGCGCCGCGCCGCCATGGTCCGCGGCCTGCACCGCGTCTACGCATCGCTGCGTGAGCGTGCAT
CGCCTGACCGATCGCTGCTCGCGATGCAGACGCTCTTCGACCTCCAGTCCATCGAGGGCTTTGAGGTCGCGCAGGTCGCGACCACGTACATGCGACTGCT
CGCGGCCGCGTGGCACCAACAGCAGCAGTCGGCACCCTCCGCGTGGCAAGAAGGCAGTGTGCCGATGCCGCAGCAGGTGAGGCGCGGCAAATAAGATATC
TGCTCAGTGTCAATGGGAAGGTTTGTCTGACCGTCGCGGTGCTGTCGTAGGCGATGCAACACCTCGCCGAGGTCTACATCATCGAGCGCATCGGCGTCCA
CCACCCGCGCCGCGTCGAGCTCCACGAGTTCCTGGACCGCGTGCCACCAGTGTTTTCCGTGGTGGACTATCTCGGGTGGAATCCGCAGACGGCGCCGCCC
GCGGGGACGGCCGAGACGTCGGCGTTCCGCCTCATGACGGATGCGCTGCTCAAGTGCTGGTTCGCGCACTCGTTGCAGCTCTCGCTCGGCTGTTCACTCG
TCCAGGTACAAAAGCACCCGTATGGCTATGGCGGTCGTGGAGCTAATGGAGCTCTTCGAAACGGCTCGTGTAGATCCTACAGCACCTGCCGCGCTTTTAC
CCGTACAAGAGCCCCGCGGAACTCTCGCCGACCGAGTACCGCGCGCAACTGCGCATGGTCACGACCACCGTTCTGGTGCTCACCAGCTTTGGGAAGCTGC
GCTGCGAGCCCGAGCTGCTGCCGCACGAGTACTTTGTGCTCAAGCAGCACCTCGTGTACCACATTGTGCGGCAGGACGTCGCCATGCTGGGCGAGATGCT
GCGGGTGCGTTACGACTCCATCTCTTTTTCGCGCGCAGTCTTCTTAGTGGTTCCCCTTTCCCCTCTATACAGGCGTTGCGCTGCTTTGACAGCGCGGACA
ATCTCATCTCGGTGCGGCGCGCGATGGCAGTCATCATGCTCTCGCAGCAGGCGGACGGATCCTGGACAGGCGTCTCTGGCGAGGCGAGCGAAAGCGACGA
CGAAACCAAGGCAGCCACTGTGTACCACACGACCATGGCGGCTTTGTATGCCTTGACCGAAGGCCGCGCGCAAGGCTTTGCGCCGTCCATTCCCATGGCC
CACAGTTTGCTAGAAGTCCACGTGAACGCCGACCTGCCACTCCCGGTACTTGAAGACGAGAAGCTCAAGAAGGCCGCATCAGCGGAGCCGGAGAGCAATG
GGTCTCCTCCGCGGGACTCGTCCAAGCCGAAAGCATCCAGCAATGGATCGCCTCCGGTTCGCGCTTCAAGCGGCAACAGCAGCACGACGGTTGCGGAGGA
ATCGCTGGAGGATCAAGTGCGATTTCACCAGGGGCTACTGGATAAGGCCGGCGACAACGTCAAGAACGTCTCGGCTGCGCTGGCTCATCAAGTGCTCGCG
ACGCTCTCGGGCATGAAACTCAACGTGGACATCCTCAAGACCACTGGCGTCGGCCGCACGATCAATAAGCTCCGCAAGCACAGCGACGACGACGTGGCGA
AAAAAGCCACGCAGCTCGTTGCCAAGTGGAAGAAAGATTTGTTAT