Description :
From Genome Similarity Track
Location :
Scaffold_71:33913- 35292
Transcript NameFunction/comments
Phyca_LT153420686Hypothetical protein

Sequence
1379 bases(100 bases per row)
cggtgttgttgctggctggatagaacaaagtaatgtaagagctaaacatggagatccgttatcaaccaaattccaaaggactttgaccatggggacgatt
catccgtggcacaagtacgtccttcaaccagacatcagtcactacgtcgtcctctccaaactccgatgtatcgtcacgctcatctctctcgtcctgttca
tgaccgacatcccccgcacaggcctgggcgtacggaacctccaggagttctacccggttcctcttatgcccagcactgccgttcgctttggaccgttcaa
ctaccccgttctacacatctcacagcgcaatcaaagcagcgaatcgtcgagtaagttcataggattcaaaggcaaacagccaactgccactgctcgcgtc
tggtcgtatcagtacgatacaacgtccgtcggactgcgaggggctgtggaattactcaacgtgacggaattcccctcttcattactgtacaaaccacaac
caggtgaacaaagcaatgccacgagtctcttggagctcagcaccgtattcacaatgttagacgccttcatctccgcttcaagggaatatctgagaccaga
tgaggacaggccgatgatgctccgctacgccaccaaacacaactgggtggatagaatgtatcactacgtcgtcagcttcgtatccaagaattctgcttgg
agactgcactcgctccatacgccacgaatctcccccgacccattgtccatctcaatctgttccaacaccaaacgatcttcaccccgacctagattctgca
atcacccagggatatggaagtgtagcaacccactcgacgcttcgctgcctcccgttcgcctttgggaccacatggacctccgtcttcagtccttacagcg
acaataccccaacttgaagcttgaggtggcactggtgtcatcccagagactctcatccacgtctggagccatgcgatccaccttctacaactacgaggcg
ctggagattgtcgtcctcactcgaggcagacgctgtactgcgggttcttgtacgacggtctttgtggacgactatcgctatgagcgagacatcgtccaga
cgaacctcgtggactggtacggtatcatttccactctgagaggtgcagctcaaggctacgtttggatacgagtgctgctcttgggctacggggcgtacgc
agctgccgagcagcccccgtcgagttgtcgatggcttgtagcagtttcgatggtgcttaaaatccctttccaagtcgtcgtgtactccagtcttttgcct
gtttgtgcgtacgttggggcgcttctcctggacagcagcttcacggatatcttcctcgattcatattgggcttcagtcg