Description :
From Genome Similarity Track
Location :
Scaffold_195:33910- 36931
Transcript NameFunction/comments
Phypl_g5071hypothetical protein PHYSODRAFT_559234

Sequence
3021 bases(100 bases per row)
gacgtGTACCGCTACGTGCACCTCAACGCGCCGGAGAAGAACGCGGCACTCGGCTACTGCTCCAACCTGGTGATCACCAGCCGCTTCACCGTGTACAACT
TTctgcccaagctgctcttcTACGAGTTCAGCAAGCTGGCCAACGCCTACTTCCTCGTCATCTCCGTCATGCAGACCATCACGCCCATCTCCAACACGGG
CGGCTTcccggcgtcgctgccggcgctgtccATCATCGTGCTCATCGACATGTTCTTCGCCTGTCTGGAGGACTACAAGCGCCACAAGGCCGACCACGTG
GCCAACAATTTGCCCTGCTTGAAGTTCCagagacgctcgaggacgtTCGAGCCGGCCAAGTGGCACACGCTGCAGGtcggcgacgtggtgaaAGTGGCCA
ACCGAGACCTGGTCCCGGCGGACCTCGTGATCCTCGGAGCGTGCGAGCCGGAGCCAGCGAACCCGGCGGGCATCTGCTACGTGGAGACCAAGtcgctgga
cggcgagaCGAACCTGAAGCTGAGGCAGGGACTCGAGGCCACgtacacggcgctgctcgaggacgcggcggtggGGGACATGGAGGGGACCGTCGTGTGC
GAGACGCCCAACAACGCGATCCACCGCTTCAGTGGGTCCATGACGCTAAACGGGGGTAAGAAGGAGGTGATCACGACCAACGCCATTGTGCTGCGCGGTT
CCACGCTGCGAAACACCGAGTACATTTACGGCCTGGTGGTGAACACGGGCCCGGACACGAAGATCAtgatggcctcgtcgtccgagcccATGAAGTGGAG
CAACATGGAAAGGCGCCTCAACAGGCAGATCCTCTACATCTGCGTGCTCATGGTGGCGCTTTGCCTGGCCGGCGCTGTCATGTCGACGGTCTGGAACGCG
CACAACTTGTCCAAGGATCGGCACAAGGCGGCGTGGTATTTGTACGACGGCGGCTCGACGGCGGTGAAGTCGCCCGTTGGAAACTTTGTCATCATGGTGC
TGTactacttcctgctgctgaattCGTTCATCCCCGTGTCGCTGTATGTGAGCATGACGTCCGTGAAGTTCATGCAGTCGTATTTCATGAACAACGACCT
GGAGATGTACCACGAGGAGTCTGACACGCCGTGCCAAGTGCGCACAATGTCCctgaacgaggagctgggcCAGATCGACTACATTTTCTCGGACAAGACG
GGCACCTTGACGTGCAACATCATGGAGTTCCGCAAGTGCTCCATTAACGGTGTAGCGTATGGTCATGGCGAGACAGAGGTGGGCATCGCAGCCAGGAAGC
gtcagcaagaagaagcgccgaTGATGTCTTCGTTCTATGCGGTGACTCCTGGTGGTGGTTACGCAGTTCCAATGAGGAAAGACCGCGTTGACACTGCACC
AGACTCGAACAATCATCCGACGGATCGCGTTGTGACAGCGCCCTTCGTGAACTATCAAGATGACGCGCTATTTGACGCACTGGCGCAGAAGAATAGTGCT
CAGGCGAAGGCCATTGGAGCATTCTTTGAACACTTGGCTGTGTGCCACACTGTCATGCCGGAAAAGGCACCGGACAACAGTCTGCGCTTGAGTGCATCTT
CTCCGGATGAACAAgcgctggttgctgcagcagcctgctTTGGCTACAAGTTCGTGGCACGTGGACCTGGTAGGGCAATGGTGGAGTATTTCTCTTGCGT
TGATCACCCTGAAGATATGACTTGCAACCAGCCCGTTGCAGAGCACCCTGTCGGAGCTTACGAGGTCCTCGAGGTTCTCGAATTTAACAGTACGCGTAAG
CGTATGTCTGTAATTCTCAAGGGACCAAACGGAGAGCTAAAACTTTTCTGCAAGGGGGCAGACACTGTGATGTACGAGCGTCTGAGGCCGACCAACGATC
CAGCTGTCAAACAGACACGCAatctgacgctgcagcacatgGAGCAGTTCGCGTCGGAGGGACTGCGTACGCTAGTGATTGGTATGACCGACATTGAACC
GGAATTCTTTGAGTCGTGGGTGATTCGGTACCGCACTGCTATCAACGATATGCGCCAGATCGATCTGCGTCGCAATGGCGAGGATAACGACATCGATCGG
CTTATGGAGGGAGTTGAGAAGAACCTGGACATCTTGGGAGCAACAGCTATTGAGGACCGACTTCAGGCTGAAGTTCCCGACACAATTTACAAGCTGCGAC
AGGCTTCGATTAAGATCTGGATGCTTACgggcgacaaggaggagacggcgaTCAACATCGGTTTTGCTTGCCGTCTGCTATCGACCGACCTCGAACGGAT
CGTGATTTCAGCAGATACGCATCCCGACTTGGCTGCTATCATGGATGAGCTGGAAGCGTACAGTCACGATGATGACAACGAAGACACTTCTGCATCGACG
CTGGCTGGAGCACCAGGTGTTGTATCGGTGTCTTCCGAAGTACGAAGCTCGGTTACACTCAGGAACCAGCATAAGCGGTTGACTCGTATCGAAAGTATGG
CTGAAATGCCGCAACAGGATTTGGCGCTGGTGATTGATGGTGAAACGCTGGAGCTTGCTCTTGAAGAATGCCCCGAGCTACTGCTAAAGGTGGCGGAGAA
GTGCGTGGCAGTGATTGCGTGCCGTGTGTCTCCTGCTCAGAAGGCGCAGTTGGTGCGACTCGTGCGGGACAACAACCCAGAAATCCGAACGCTTGCCATC
GGTGATGGTGCCAACGATGTCTCCATGATTCAGGCGGCGCACGTGGGTGTTGGTATCTCTGGCCAGGAAGGCATGCAAGCTGCAAACTCGTCGGACTATG
CCATCGCGCAGTTCCGTTTCCTGTCACGACTGCTACTTGTCCATGGACGCTGGAATTACGTGCGCATGGGCAAGCTGATCCTGTACATCTTCTACAAGAA
CGTGATTCTGAACTTGACGCAGTTCTGGTACATGATCTACACGGGCTACTCGGGACAGAAGTTCTTCCTCGAATGGGGACTTCAGGGATACAATCTGCTC
TTCACAGCTTTGCCAATTGTT