Description :
From Genome Similarity Track
Location :
Scaffold_723:3391- 6502
Transcript NameFunction/comments
Phyag_g7700hypothetical protein
Phyag_g7701hypothetical protein

Sequence
3111 bases(100 bases per row)
TaccaggagaaggagaagggaTACTCCAGTCGCTACGCCGATGATAATCGTGGTATGTAGCGGCTTTGCAGCAGGTCGCATTGGAGGAATTTGACGCTAA
CGAAGGGACTTGTGTGTGATTAGACGATGAAAGCGACGAGTCCGAGTCTGAAGAGGAAGTGCGCTCGAAGCGACGGACAGCGTCGTCCAAgcggaaggcg
aagaagaaagaggtAGGCTTTACCTGTAGTGTATTTATTCGTACCGTACATTTTTGTCTAGAAATGCTGACCATCTTGTTGCGATTTACAGGAGAGTGAA
AGCAAGCCTGCAGCCAAGGCCCCCTCTGCGGAGCCGTCTCTCTTGGACAgcgacttcttcagcgcTGCTCCCGCCCCAGGTAATTTTCATTTTACTTTGA
AGATATGCTGCTGTTTTAACCCGGATGGCTGATACCTCGCTGTAGCTGCCCCCGCAGCGAACACATTCGACCCTTTCGCTCCGGCACCTGCGGTTCCCGC
GGCTGCTCCTCAAACGGCGTCATTCGCCGCGTTCGGCAACGCAGCCCCCGCGCCGCAGCAGTCGTTCAACGCTTTCGGTTCACCGCAGGCACAGCAAGCC
TCATTCGACGCATTTGGAaacgctggtgctccagCTCAAGCCAACTCgcagcaatttgctgctTTCCAGTCTGCACCGGCTCAGCAAGGCTTCAATGCAT
TCGGTCAGCAAGGtaacgctgcagctcctcccGCTCCTGCTTtcaaccagcaacagcaatttGGACAATTCGGTGGCATGCAAGGAGGTATGCAAGGAGg
tatgcagcagcagcctaTGCAGGGCGGTATGAACATGCAGGGCGCGGCCCAGGGCCAGAATGCTCAGTCACGATCGAACTCGGGTCCGATGCCTActgag
aagaagagcaacgaCGCGTGGGGAGCTGGTTCTTCGCTATTTGATCTTAATAACCTCGCGAGCTCTACCAgcagtaacagcagcagcgcaggtcgtccag
gtcagccgcagcaacagcagcagcagtcaaaTGCAGGTCGCAATAGCTTCAGCGGTCTGGATACTCTTGCTGGCATGCCTAGTAAGCCGGCGATgggagg
cgctggtggcATGAACCCCATGGGCGCGGGAATGAACTACGGTGGAGGCATGGGAATGAACCAGGGtggcatgcagcagcaaccttACGGACAAATGCAA
ATGGGAGCTGGAGGTATGCCTATGGGTGGCATGGGTATGCAGCAGCCTCGGCCGATGATGGGAGGTATGGGCATGCAACAGCCAGGCATGGGTATGCAGC
AACCTGGCATGGGCGGCATGATGAACCAAGGTGGCTTCAGCGggatgcaacagcaacagcaacagcagcagcaacagcgacagcagcaggccTTCAGTTC
ATTCGGCAATTTTAGCTGAAgacgagcgctgcagcctcACTGCAAAAAGTGAGGCCACAGGTGTCCAGCATGCTGATAATACATGGTGAAAGCGGGAATG
GCAAGTTGATGCCTACCGTCCAAACAATTAGACGTAAAGACTTCAACCGCAACGGAGTTGTCGGTAATGCTTCTGCAGAATGGATGATAGACATGTGCCA
CATTCCTGGCGGCGTAAATGATCTCAGCATTTGTAGGCCTTGCCATCTTTTGCATCTAAGGGCCAACCAGACTCATTGAGACCTGCAGTTTACACTGCAA
CAAGGAAGAACCAATTCCACACATTGATCATTGGCGCTTTGTGTAGTATCCAAAACGCCTCAATTGACATCCCTCCCTCCGCTGGTGACGCTGATGTTTC
ACCGCAGAGGTGCTAGAaggtgatggaggagatctGTATGCACACTCGCACTACTCATCCACACTAACAACTCCGTCTCTTCCTCAAAGATGCAAGATCA
CTCTCACCTTGCATCTTTGCTGCATTCCACGTGAACTTACCACTTCACCGGTGGTGAGAATTCCCTCCTGCTGCAtccaacagcaagaagcagaagcagc
tcgtgacTGATGATGCTCCTTAAACATGGTCGAGTATCAGAAATCCTGTAATTGGAGTTCCTCTGCTCCATCAGGAACACGCCGACAATTGTCCGCGTTT
CTTGCCAAACAGTGCGTTCTGCGGTGACTGTGGCTGTGTCGTGCATCCGCCGGCATCTTCCATATTCTGGTCCTGCTCTCGTCTCTCTCTCTGTCTCGCT
GCGAACGCCTGGTACaagtctcctccagcgctgctgctgcgggacAATTTCCCATTTGCGGAGGACGTTTTGGCCAAAATGTTAATCTGGCtggacgtct
tcttcaaacTCACACGTGGCTCGTcctctcctccaccttctgcatTGTCCACGTGGACAGATTTACGTTTCCGCAGCCCTTCCGGGTACTTGTTGAGGAC
ACTGAACGGCGACAAGACCCTCAAATGACCAGGTATGGACAATCTGGCTTGTCTCTTCTtcggacgtggaggagaGTGGACAGCATTActgtcgtccacc
tccatgtcctccagCATGGGGGtgatctccacctcgtccacgcTCATCATGGCCTCGAGTCCTCCGTCGTCCTCGTGTGTCCTGCTATCCGTTCTCTGTc
ctctgctctgctgcttcagtcTCAGTTGCTTCCTTAACACGTCACGGGGCTGAGGGGACGACGGTGGAGTGCTGGGGCGTTCGGGAGGTAGCAATGGGAA
CACTTTGAAATGTTCCGAGGCGGAGGCggatccgctgctgctgctgcgtcgacgtcgtctctcctgctcctgttcttcttcctctaTTGTGGATGACGCG
GCGTCcgtggcgacggcgatgcGTGTGAGTTTTTCCCTTAAAAGGACCATGTCTTCGTGGTCGCTCACGAACGAGTTGCGGCGCAGTTTGGAGCTGATGT
TCACGGCGGCGTCGGGCGTCATGGAGCGGCTCTTGGCGCGCAGGATGGGGCTGGCAGGCATCATCTCGCTTCTCTTCTCTTGTCGTGCTTCGGGGCTTGG
ACGAATACAGGCAGGCTGGAAGAGCCGTTCGGACGAGAATTCTTCCGCCGAATCTGGTGGGTtatgttgctggtggtgtggAGTTGGGACACCATGTGCA
ACAGTAGAACC