Description :
From Genome Similarity Track
Location :
Scaffold_42:339054- 346817
Sequence
7763 bases(100 bases per row)
TCCACGATGGGTGCATGCGTGCCAGGAGAGGGGGGGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCTTCCCGACCCACACCC
TTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACGCTTCTTCATGAGACTGCATCACGCCGAATCTG
TTCCGATTCGTACGATCCCGCAAGAAATCATAGAGTGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCCCGCCAATACACCA
GAAAACCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCCTCGAGGTCCACATTCCA
ACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCTATTCGGTCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTC
AGCTTAAATACGTGTACTACAGGGAACAGGCGATATCTGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCTATCTTCTCGCTCACCCGGAACGGTC
CATGCCATAGATGGGACAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTC
TTCGTTGTGTCGATCTTGTATCGCACTCCGCAGCCGTTCGCTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGA
TCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCTGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCCCCCGGAT
CCCGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGCTCTGTGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTG
ATCGTCTGCACCATGCGTTCAGCCGACCCGTTAGCTTGAGGACGATATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTGAATGCTCGAAAGA
AATCAGACATAAAACCTGGCTCCCGATCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGCGC
AGTTCTAGACGCACTAGCTTTGGCTATCACGTACCCGGTAAACAGATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGA
ATATGATCCATGGCTATGATCTGGAAAGGGTAATTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCA
CACATTCACCGACATATCGTTGCACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTTCACC
TTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACAAATCTCATCAACCCATCCCGATCCTCGTTGACTCTCTTCGTA
GGGGGGGGCAACAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTTGGATTTGGTATCCTCTTGAATCAGGTCTCGTACATC
CCGCATCCGGTCTCCATAAGTCCCAAGATCCACGCTTTCTCGTTTTGTGCTTTGAGGATCCGTTCAATGCGGACTCCCTTCACAAATGTTTCATCGAGGA
TCTGGGGGCTGGATCCAATCCTTTCTCTGCACCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCATCACCATCTCATCTAGTCGGTT
CAACGTAACGACATCCTGATGCTCGGCCTCTCTCTCCACTTCGACACCACATTAATTTCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAA
TCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAAAAGTGTTAGGGCGGGGCCTTGCAGTCAATCTC
ACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACCAGTCCTGTCCCTTCAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTT
CATTGACGGTGAGGCCCTCCGCATAAGTGGGTCTGGCCCGTACAACTTCGCATCCGGGCAGTCGCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCG
TACGCGAGCGGATCCATCGAAACTCAGGCCGTACAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGA
GCGATCCTAGTCAGCGCTTTATCCATCTTAGCTCGATGTGTGATGCTCACGGCCAAGACGCCTCAGGATCTCGTCTTCTCCTTTCGAACATTTCACAATC
TCTAGTGTCCAAGGCGAGAGTAAAGCTGCTCCACTGTCCTCATCGTCCTTGTGAATCTGGCTCGACTTGAACAACCAAGCTAGCGTAGAGTGTCAAGTCA
GGATCCGGATGGATCTTCTCACCAGCAGGTTGTAATGAGATCCACACGCGCAGAGCGCGAGTATCTCTTTCTACATCTCTCGTAATTCAGCTCATTCGGC
TTTAGCGTAGGGCAGACAAAGGTGACTGGATGGCAGATCCCCTCATGTTCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTAGCATAGACTATCACCG
TAGGCTGACATTCCAGATCGAAATGGCGGAGGAAGGGCGTCGTCGCGATCCTGTTCCTTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTC
TACCTTTTCCGAGTTCTCTTCCGTCGTCTCTATCCAGATTGGATCCTCTTCCCGTTGGTCTCGGGGTGGATCCAGTTCCGGTTTTACGTCCTCTTCCAAC
GTCGTACTACTTGGACCCCCACGTGGATCTGGGATCACTAGGGCCAGAGCTTGTTCGATCTTGATCCGGACAGCCGAAGTGACCATCGCAGCAAACTCCA
CTTCCCTCAATTCATAGAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATTGCCCGTAA
CGACTGCGGGAAGGACAAATCGGCCAGCGAAGACAGATCTTTAGGGCTCACCTCCAATCCCTCCTTGGAGACTCTATGACCTAAATAATCCACCTTGCGC
ACCCCCCAATAACTCTTCACCACGCTGATAGAGAGGTCCCACCTAGTACACGCCCCCAGTAGGGATGTCACTCTCTCGCACAGCTAATCCTACGATTCCG
CCGGGATTAGAATGTCGTAGATATAGGACCTACCCCCTAACACGGATGGTGTTTCCAGATCGCCTAGCTCTCCTGCTTCGAATGGATCCACTTCCGTATG
CCCTTCCCCGGATCCACTCCTTTCGGGTTCCGGTATTCGGGTGAATCCTTAGAGGGCGTTATCCATCAGGCGCTGGTAGATCTGGGGTGCGTTCTTCAAT
CCGAACGGCATCCGGTTCCACTTGAACAGTCCAAACGGTGTGATGAATGCGAATATCGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGG
CCATGTCCAGAGAACAGTACCAGAGCACTGAATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATTGGATACACCATCAATCGAGTCAGGCCGTTAAC
CAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGACGCCCACGGGGACATTGAGAAACCGATGATCTTG
GCTTGCACCAGGCCCTGAATCAGATCCGATAATTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGGGCGATCGGTTTCGCGTCGCCGACATCGA
TGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGCCGGCTTTCCCCGATCTTCTGACGTAACTGATCCACTTC
CGCGGGTTCGTTCGCCCCTGGTTCCACTTGAATATCGTCAATCGTGACCTCTTCTGTGGTCATTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAAGA
TCCTCGGCGTGTAAATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCATCGGATCCACCATTGGATCCAAGCACCGCGACCCTGTTTCCT
CTGTCAGTCCTTCTGTCTTCGTGGGATCCGGTACCCCAGTACCGGGGAAGCCACCAGTTGGATCGACTTGATCATCTAGCGAGTTTAAACACGACGGTTC
TTGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTGCCCCATTTAAAGTTAGGATCCACTCCGGGGTCAGCGGGATCTGGCGGTCCGGCT
ACAGCCTTCTGTGATCCTTCATCCACCGACCCTGAGTTATCTAGGGGCCGACTCTGGGGATCATTCCCGGTCTTGGATCCAACCTCTACCGCTTGGATCT
CAATCCGACGATCCCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACAAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCCCTTCTCCGAG
AGACTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCCAACCATCGCCCGATCTCCTCATAATGATCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCCTGAA
TTACGGTAGGCACCCATTTCTCGCCCCGAGTGATCCACTGTTTCTCATGTTCCACCCACTTCAACCGATATGGCAATTCCCAGGTTTATCTGGGCTCGAT
CCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CAATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCGAGGATGGCGTTTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGT
ACACCAAACAACCTGCCAACGTGATCTTGATTCGCGTTCTTCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCC
CCTACCTTGGCTTGTCTGAACCATTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGGTCCATGGATCTAACATCCTCAGATC
CACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGTGTTTCTCCCAATAACC
ACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTTCTGCTACCTGGATCTAGCGATGCCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGG
CTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATATTCTCGGCCACTTCTGGCAACATTCCTCTGTGCTTGGCTGGATCAAACCACTGGCGG
ATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCAGCGTCGTGAATCTCGCCACAGCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCT
TGCCACATTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCGGTGTGCTTTCGGGATCCGC